Incidental Mutation 'R4082:Col14a1'
ID316961
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Namecollagen, type XIV, alpha 1
Synonyms5730412L22Rik
MMRRC Submission 041624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4082 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location55307750-55520803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55437033 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 986 (Y986H)
Ref Sequence ENSEMBL: ENSMUSP00000105850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
Predicted Effect unknown
Transcript: ENSMUST00000023053
AA Change: Y989H
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: Y989H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110217
AA Change: Y990H
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: Y990H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110221
AA Change: Y986H
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: Y986H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187158
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
1700021P04Rik T G 19: 24,066,002 noncoding transcript Het
a A T 2: 155,045,758 D46V probably damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Abca12 G T 1: 71,267,463 T2028K possibly damaging Het
Abt1 T C 13: 23,422,146 T213A probably benign Het
Adcy1 A C 11: 7,064,117 Y173S probably damaging Het
Aim2 T C 1: 173,459,851 probably null Het
Akr1d1 G A 6: 37,557,489 V193M probably damaging Het
Cars C T 7: 143,569,497 E461K probably damaging Het
Ccdc80 T C 16: 45,122,927 L800P probably damaging Het
Ccl22 A G 8: 94,746,908 Y27C probably damaging Het
Cdc123 G A 2: 5,810,755 probably benign Het
Cldn11 A T 3: 31,163,129 I149F probably benign Het
Col6a3 G A 1: 90,821,883 L410F probably damaging Het
Crocc T C 4: 141,033,971 probably null Het
Cubn A G 2: 13,428,563 probably benign Het
Cwc25 G T 11: 97,753,918 Q205K probably benign Het
Cyp2e1 T C 7: 140,771,078 I321T possibly damaging Het
Eps8l1 T A 7: 4,470,798 probably null Het
Fasl C T 1: 161,781,851 V189M probably damaging Het
Fbxw5 T C 2: 25,504,631 probably null Het
Flg2 A C 3: 93,203,521 E952A unknown Het
Gpd1l A T 9: 114,917,078 L90Q probably damaging Het
Grik4 G T 9: 42,597,884 F414L probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl3 C T 13: 58,018,797 G407S probably null Het
Lmbr1 T C 5: 29,258,755 E157G probably damaging Het
Lrp2 T A 2: 69,513,273 H914L probably damaging Het
Mrpl20 A T 4: 155,808,513 D67V probably damaging Het
Myo15 A G 11: 60,487,196 T1346A possibly damaging Het
Naip5 A T 13: 100,245,830 C124S probably damaging Het
Olfr1123 T A 2: 87,418,457 Y134* probably null Het
Olfr654 T A 7: 104,588,623 V290D probably damaging Het
Olfr702 T C 7: 106,824,038 T163A possibly damaging Het
Osbp A G 19: 11,978,666 D385G probably benign Het
Paip1 G A 13: 119,457,004 D460N probably damaging Het
Pde3b T C 7: 114,494,588 S356P probably benign Het
Pms2 A G 5: 143,931,019 M814V probably damaging Het
Polg C A 7: 79,464,828 K128N probably damaging Het
Polk G T 13: 96,483,673 T694K probably benign Het
Pom121 T C 5: 135,388,637 K342R unknown Het
Pou5f2 T C 13: 78,025,905 L322P probably damaging Het
Ptpn6 T C 6: 124,728,419 D183G probably damaging Het
Pygb G A 2: 150,826,471 probably null Het
Ralgds C T 2: 28,552,271 probably benign Het
Ret T C 6: 118,153,966 T1079A possibly damaging Het
Rspo2 A C 15: 43,022,537 V241G probably benign Het
Smg1 T A 7: 118,160,246 probably benign Het
Snph T C 2: 151,593,802 D402G probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Stard13 C A 5: 151,092,829 probably null Het
Sufu A G 19: 46,425,102 M141V probably damaging Het
Sytl2 T A 7: 90,408,427 V831D possibly damaging Het
Tc2n T C 12: 101,651,155 E335G possibly damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmcc1 T A 6: 116,043,480 H118L probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vmn1r209 A C 13: 22,805,615 L302V probably null Het
Vmn2r117 C T 17: 23,460,106 V715I probably benign Het
Vopp1 A T 6: 57,789,979 Y37* probably null Het
Xrn1 A G 9: 95,981,920 T528A probably benign Het
Zfhx2 T C 14: 55,065,205 D1774G probably benign Het
Zfp955b T A 17: 33,302,155 D199E probably benign Het
Zp2 T C 7: 120,135,252 S525G probably benign Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55411585 missense unknown
IGL01290:Col14a1 APN 15 55423507 missense unknown
IGL01300:Col14a1 APN 15 55467976 missense unknown
IGL01505:Col14a1 APN 15 55455223 missense unknown
IGL01533:Col14a1 APN 15 55420840 missense unknown
IGL01563:Col14a1 APN 15 55487941 missense unknown
IGL01650:Col14a1 APN 15 55406693 missense unknown
IGL01659:Col14a1 APN 15 55446172 unclassified probably benign
IGL01670:Col14a1 APN 15 55329266 missense unknown
IGL01760:Col14a1 APN 15 55423459 missense unknown
IGL01803:Col14a1 APN 15 55418814 missense unknown
IGL01966:Col14a1 APN 15 55448725 unclassified probably benign
IGL01990:Col14a1 APN 15 55363463 missense unknown
IGL02124:Col14a1 APN 15 55463703 missense unknown
IGL02138:Col14a1 APN 15 55420835 missense unknown
IGL02192:Col14a1 APN 15 55362402 missense unknown
IGL02326:Col14a1 APN 15 55418797 missense unknown
IGL02335:Col14a1 APN 15 55463769 splice site probably benign
IGL02407:Col14a1 APN 15 55448876 splice site probably benign
IGL02486:Col14a1 APN 15 55388696 splice site probably benign
IGL02537:Col14a1 APN 15 55344914 nonsense probably null
IGL02567:Col14a1 APN 15 55344961 critical splice donor site probably null
IGL02643:Col14a1 APN 15 55420862 missense unknown
IGL02669:Col14a1 APN 15 55418782 missense unknown
IGL02673:Col14a1 APN 15 55418782 missense unknown
IGL02674:Col14a1 APN 15 55418782 missense unknown
IGL03201:Col14a1 APN 15 55408904 missense unknown
IGL03334:Col14a1 APN 15 55448821 unclassified probably benign
IGL03370:Col14a1 APN 15 55488541 splice site probably null
IGL03385:Col14a1 APN 15 55410204 missense unknown
IGL03385:Col14a1 APN 15 55471708 missense unknown
PIT4131001:Col14a1 UTSW 15 55448876 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0173:Col14a1 UTSW 15 55488532 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55407868 splice site probably benign
R0391:Col14a1 UTSW 15 55446259 unclassified probably benign
R0468:Col14a1 UTSW 15 55388646 missense unknown
R0652:Col14a1 UTSW 15 55344882 missense unknown
R0692:Col14a1 UTSW 15 55341738 missense unknown
R0745:Col14a1 UTSW 15 55338417 missense unknown
R1006:Col14a1 UTSW 15 55519935 missense probably benign 0.04
R1331:Col14a1 UTSW 15 55410188 missense unknown
R1537:Col14a1 UTSW 15 55380767 missense unknown
R1557:Col14a1 UTSW 15 55388579 missense unknown
R1721:Col14a1 UTSW 15 55447462 unclassified probably benign
R1737:Col14a1 UTSW 15 55344961 critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55382495 missense unknown
R1867:Col14a1 UTSW 15 55447462 unclassified probably benign
R1868:Col14a1 UTSW 15 55447462 unclassified probably benign
R1991:Col14a1 UTSW 15 55449940 missense unknown
R2020:Col14a1 UTSW 15 55446181 unclassified probably benign
R2103:Col14a1 UTSW 15 55449940 missense unknown
R2116:Col14a1 UTSW 15 55407764 missense unknown
R2163:Col14a1 UTSW 15 55444645 unclassified probably benign
R2207:Col14a1 UTSW 15 55463686 missense unknown
R2215:Col14a1 UTSW 15 55380842 missense unknown
R2264:Col14a1 UTSW 15 55466690 splice site probably null
R2383:Col14a1 UTSW 15 55447517 unclassified probably benign
R2397:Col14a1 UTSW 15 55338439 missense unknown
R2422:Col14a1 UTSW 15 55449922 missense unknown
R3793:Col14a1 UTSW 15 55363513 missense unknown
R4112:Col14a1 UTSW 15 55363559 missense unknown
R4519:Col14a1 UTSW 15 55388579 missense unknown
R4628:Col14a1 UTSW 15 55449833 nonsense probably null
R4692:Col14a1 UTSW 15 55423468 missense unknown
R4696:Col14a1 UTSW 15 55372602 missense unknown
R4749:Col14a1 UTSW 15 55452336 missense unknown
R5324:Col14a1 UTSW 15 55338445 missense unknown
R5382:Col14a1 UTSW 15 55362436 missense unknown
R5634:Col14a1 UTSW 15 55518298 missense probably damaging 1.00
R5781:Col14a1 UTSW 15 55423512 missense unknown
R5828:Col14a1 UTSW 15 55436976 missense unknown
R5873:Col14a1 UTSW 15 55445786 unclassified probably benign
R5966:Col14a1 UTSW 15 55452383 critical splice donor site probably null
R6106:Col14a1 UTSW 15 55520008 missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55380850 missense unknown
R6319:Col14a1 UTSW 15 55516169 missense probably damaging 0.99
R6475:Col14a1 UTSW 15 55445822 unclassified probably benign
R6540:Col14a1 UTSW 15 55372581 missense unknown
R6893:Col14a1 UTSW 15 55444648 unclassified probably benign
X0023:Col14a1 UTSW 15 55423447 missense unknown
X0063:Col14a1 UTSW 15 55410215 missense unknown
Predicted Primers PCR Primer
(F):5'- TACCTGGAGATACAATGCTGC -3'
(R):5'- CTCATATTCCCAGGCAGCAAG -3'

Sequencing Primer
(F):5'- GAGATACAATGCTGCAAATAAATGC -3'
(R):5'- CCAGGCAGCAAGAACTATTATTTTTC -3'
Posted On2015-05-15