Incidental Mutation 'R4083:Pcdh10'
ID316972
Institutional Source Beutler Lab
Gene Symbol Pcdh10
Ensembl Gene ENSMUSG00000049100
Gene Nameprotocadherin 10
Synonyms6430521D13Rik, OL-pc, 6430703F07Rik
MMRRC Submission 040978-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R4083 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location45378398-45435623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45392707 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 979 (D979A)
Ref Sequence ENSEMBL: ENSMUSP00000131600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554]
Predicted Effect probably damaging
Transcript: ENSMUST00000166126
AA Change: D979A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: D979A

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
Pfam:Cadherin_C_2 713 838 5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170695
AA Change: D979A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: D979A

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171554
AA Change: D979A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: D979A

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195655
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 31,986,784 S749P probably benign Het
Ccdc159 T C 9: 21,929,403 S89P possibly damaging Het
Cnbd1 A T 4: 18,886,042 S326T possibly damaging Het
Dpy19l1 G A 9: 24,485,048 T124M possibly damaging Het
Fmod A T 1: 134,040,305 I28F probably benign Het
Gm8674 A T 13: 49,901,011 noncoding transcript Het
Grm3 T G 5: 9,512,054 I599L probably benign Het
Hgf G T 5: 16,615,858 G668* probably null Het
Hsd17b11 A T 5: 103,990,568 V280D possibly damaging Het
Igkv8-26 G T 6: 70,193,563 S46I probably damaging Het
Kdm7a T C 6: 39,152,814 E476G probably damaging Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,790,494 N437K probably benign Het
Mterf4 A C 1: 93,304,658 M157R possibly damaging Het
Nbas T C 12: 13,474,191 W1683R probably damaging Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Olfr116 T G 17: 37,624,425 D70A probably damaging Het
Olfr706 G T 7: 106,886,644 P58T probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rab27a G T 9: 73,082,439 R64L probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc22a16 T A 10: 40,574,069 L167Q probably damaging Het
Srgap1 A G 10: 121,785,690 V989A probably damaging Het
Sstr2 T C 11: 113,625,245 V330A probably benign Het
Tdrd1 T C 19: 56,843,230 M351T probably benign Het
Trav7d-3 C A 14: 52,744,755 H84Q probably benign Het
Other mutations in Pcdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Pcdh10 APN 3 45380302 missense probably damaging 1.00
IGL01115:Pcdh10 APN 3 45392775 missense probably damaging 1.00
IGL01535:Pcdh10 APN 3 45379643 missense probably damaging 1.00
IGL01600:Pcdh10 APN 3 45379487 missense probably damaging 0.98
IGL01625:Pcdh10 APN 3 45379397 missense probably damaging 0.99
IGL01966:Pcdh10 APN 3 45380298 missense probably benign 0.05
IGL02232:Pcdh10 APN 3 45380942 missense probably benign 0.00
IGL02490:Pcdh10 APN 3 45380487 missense probably damaging 1.00
IGL02890:Pcdh10 APN 3 45392617 missense probably damaging 1.00
IGL02976:Pcdh10 APN 3 45380013 missense possibly damaging 0.92
IGL02997:Pcdh10 APN 3 45379362 missense probably damaging 1.00
IGL03006:Pcdh10 APN 3 45379502 missense probably damaging 0.99
IGL03385:Pcdh10 APN 3 45381512 missense possibly damaging 0.77
R0025:Pcdh10 UTSW 3 45380499 missense possibly damaging 0.93
R0157:Pcdh10 UTSW 3 45379701 missense probably damaging 1.00
R0372:Pcdh10 UTSW 3 45379497 missense probably damaging 1.00
R0652:Pcdh10 UTSW 3 45379764 missense probably damaging 1.00
R0760:Pcdh10 UTSW 3 45380570 missense probably benign 0.19
R0976:Pcdh10 UTSW 3 45380801 missense probably damaging 1.00
R1307:Pcdh10 UTSW 3 45381879 missense probably benign 0.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1510:Pcdh10 UTSW 3 45379403 missense probably damaging 1.00
R1619:Pcdh10 UTSW 3 45380312 missense possibly damaging 0.94
R1678:Pcdh10 UTSW 3 45381881 nonsense probably null
R1687:Pcdh10 UTSW 3 45380015 missense probably damaging 1.00
R1750:Pcdh10 UTSW 3 45381881 nonsense probably null
R1751:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1767:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1857:Pcdh10 UTSW 3 45379937 missense possibly damaging 0.86
R2086:Pcdh10 UTSW 3 45380471 missense probably damaging 0.98
R3960:Pcdh10 UTSW 3 45379314 missense probably benign
R4084:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4112:Pcdh10 UTSW 3 45381620 missense probably damaging 1.00
R4754:Pcdh10 UTSW 3 45380637 missense probably damaging 0.99
R4946:Pcdh10 UTSW 3 45379482 missense probably damaging 1.00
R5039:Pcdh10 UTSW 3 45381861 missense probably damaging 1.00
R5224:Pcdh10 UTSW 3 45392814 missense probably damaging 0.99
R5233:Pcdh10 UTSW 3 45384191 missense probably damaging 1.00
R5261:Pcdh10 UTSW 3 45381812 missense probably damaging 1.00
R5429:Pcdh10 UTSW 3 45384200 missense probably benign 0.00
R5488:Pcdh10 UTSW 3 45381368 missense probably damaging 1.00
R5558:Pcdh10 UTSW 3 45384168 missense probably damaging 1.00
R5784:Pcdh10 UTSW 3 45380640 missense probably damaging 1.00
R5815:Pcdh10 UTSW 3 45392721 missense probably benign 0.04
R6283:Pcdh10 UTSW 3 45381554 missense possibly damaging 0.46
R6396:Pcdh10 UTSW 3 45380060 missense possibly damaging 0.46
R6703:Pcdh10 UTSW 3 45381299 missense possibly damaging 0.87
R6756:Pcdh10 UTSW 3 45380106 missense possibly damaging 0.80
R6968:Pcdh10 UTSW 3 45379542 missense probably damaging 1.00
X0013:Pcdh10 UTSW 3 45379566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACCGTCGAATACATCTGG -3'
(R):5'- TATGCAGGCTTCTGTGTGATACTTAC -3'

Sequencing Primer
(F):5'- GACCGTCGAATACATCTGGAGTTC -3'
(R):5'- ACTCAAATATGGTGGTTTGTAAGGC -3'
Posted On2015-05-15