Incidental Mutation 'R4083:Ccdc159'
ID316980
Institutional Source Beutler Lab
Gene Symbol Ccdc159
Ensembl Gene ENSMUSG00000006241
Gene Namecoiled-coil domain containing 159
Synonyms2510048L02Rik
MMRRC Submission 040978-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4083 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21927471-21935872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21929403 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 89 (S89P)
Ref Sequence ENSEMBL: ENSMUSP00000150744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006403] [ENSMUST00000046831] [ENSMUST00000170304] [ENSMUST00000213698] [ENSMUST00000214569] [ENSMUST00000214734] [ENSMUST00000216710]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006403
AA Change: S81P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006403
Gene: ENSMUSG00000006241
AA Change: S81P

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
coiled coil region 152 172 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
coiled coil region 261 288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046831
SMART Domains Protein: ENSMUSP00000048832
Gene: ENSMUSG00000040883

DomainStartEndE-ValueType
Pfam:DUF4149 17 119 1.2e-27 PFAM
transmembrane domain 164 186 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170304
AA Change: S89P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126474
Gene: ENSMUSG00000006241
AA Change: S89P

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 160 180 N/A INTRINSIC
low complexity region 225 235 N/A INTRINSIC
coiled coil region 269 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213698
Predicted Effect probably benign
Transcript: ENSMUST00000214569
Predicted Effect possibly damaging
Transcript: ENSMUST00000214734
AA Change: S89P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215650
Predicted Effect probably benign
Transcript: ENSMUST00000216710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217589
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 31,986,784 S749P probably benign Het
Cnbd1 A T 4: 18,886,042 S326T possibly damaging Het
Dpy19l1 G A 9: 24,485,048 T124M possibly damaging Het
Fmod A T 1: 134,040,305 I28F probably benign Het
Gm8674 A T 13: 49,901,011 noncoding transcript Het
Grm3 T G 5: 9,512,054 I599L probably benign Het
Hgf G T 5: 16,615,858 G668* probably null Het
Hsd17b11 A T 5: 103,990,568 V280D possibly damaging Het
Igkv8-26 G T 6: 70,193,563 S46I probably damaging Het
Kdm7a T C 6: 39,152,814 E476G probably damaging Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,790,494 N437K probably benign Het
Mterf4 A C 1: 93,304,658 M157R possibly damaging Het
Nbas T C 12: 13,474,191 W1683R probably damaging Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Olfr116 T G 17: 37,624,425 D70A probably damaging Het
Olfr706 G T 7: 106,886,644 P58T probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rab27a G T 9: 73,082,439 R64L probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc22a16 T A 10: 40,574,069 L167Q probably damaging Het
Srgap1 A G 10: 121,785,690 V989A probably damaging Het
Sstr2 T C 11: 113,625,245 V330A probably benign Het
Tdrd1 T C 19: 56,843,230 M351T probably benign Het
Trav7d-3 C A 14: 52,744,755 H84Q probably benign Het
Other mutations in Ccdc159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Ccdc159 APN 9 21929469 missense possibly damaging 0.83
IGL02322:Ccdc159 APN 9 21929373 missense possibly damaging 0.46
IGL03156:Ccdc159 APN 9 21929475 missense probably benign
IGL03382:Ccdc159 APN 9 21931696 splice site probably null
R1622:Ccdc159 UTSW 9 21929370 missense possibly damaging 0.66
R2076:Ccdc159 UTSW 9 21929506 unclassified probably null
R3905:Ccdc159 UTSW 9 21934519 critical splice donor site probably null
R4625:Ccdc159 UTSW 9 21929466 missense probably benign
R4700:Ccdc159 UTSW 9 21927731 splice site probably null
R5004:Ccdc159 UTSW 9 21932945 missense probably damaging 1.00
R5743:Ccdc159 UTSW 9 21929390 missense probably benign 0.19
R6245:Ccdc159 UTSW 9 21935568 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGACATTTGGAGGCCTGGG -3'
(R):5'- TCTGAAACAGAGTACAGACCCTG -3'

Sequencing Primer
(F):5'- CCTGGGAGGGGCTGACAATTAC -3'
(R):5'- GTGCACAGCAAGTTCACTCTTAGG -3'
Posted On2015-05-15