Incidental Mutation 'R4083:Slc22a16'
ID316983
Institutional Source Beutler Lab
Gene Symbol Slc22a16
Ensembl Gene ENSMUSG00000019834
Gene Namesolute carrier family 22 (organic cation transporter), member 16
SynonymsOKB1, FLIPT2, OCT6, CT2, 4921504E14Rik
MMRRC Submission 040978-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4083 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location40570336-40604132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40574069 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 167 (L167Q)
Ref Sequence ENSEMBL: ENSMUSP00000077428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019978] [ENSMUST00000078314]
Predicted Effect probably damaging
Transcript: ENSMUST00000019978
AA Change: L188Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019978
Gene: ENSMUSG00000019834
AA Change: L188Q

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Pfam:Sugar_tr 136 556 6.4e-25 PFAM
Pfam:MFS_1 177 514 3.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078314
AA Change: L167Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077428
Gene: ENSMUSG00000019834
AA Change: L167Q

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 114 535 5.1e-26 PFAM
Pfam:MFS_1 156 493 4.7e-20 PFAM
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic zwitterion transporter protein family which transports carnitine. The encoded protein has also been shown to transport anticancer drugs like bleomycin (PMID: 20037140) successful treatment has been correlated with the level of activity of this transporter in tumor cells. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 31,986,784 S749P probably benign Het
Ccdc159 T C 9: 21,929,403 S89P possibly damaging Het
Cnbd1 A T 4: 18,886,042 S326T possibly damaging Het
Dpy19l1 G A 9: 24,485,048 T124M possibly damaging Het
Fmod A T 1: 134,040,305 I28F probably benign Het
Gm8674 A T 13: 49,901,011 noncoding transcript Het
Grm3 T G 5: 9,512,054 I599L probably benign Het
Hgf G T 5: 16,615,858 G668* probably null Het
Hsd17b11 A T 5: 103,990,568 V280D possibly damaging Het
Igkv8-26 G T 6: 70,193,563 S46I probably damaging Het
Kdm7a T C 6: 39,152,814 E476G probably damaging Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,790,494 N437K probably benign Het
Mterf4 A C 1: 93,304,658 M157R possibly damaging Het
Nbas T C 12: 13,474,191 W1683R probably damaging Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Olfr116 T G 17: 37,624,425 D70A probably damaging Het
Olfr706 G T 7: 106,886,644 P58T probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rab27a G T 9: 73,082,439 R64L probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Srgap1 A G 10: 121,785,690 V989A probably damaging Het
Sstr2 T C 11: 113,625,245 V330A probably benign Het
Tdrd1 T C 19: 56,843,230 M351T probably benign Het
Trav7d-3 C A 14: 52,744,755 H84Q probably benign Het
Other mutations in Slc22a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc22a16 APN 10 40595282 missense probably damaging 1.00
IGL00334:Slc22a16 APN 10 40573934 missense probably benign 0.03
IGL00757:Slc22a16 APN 10 40581327 missense probably damaging 1.00
IGL01082:Slc22a16 APN 10 40573864 missense probably benign 0.40
IGL01337:Slc22a16 APN 10 40595314 missense possibly damaging 0.51
IGL01389:Slc22a16 APN 10 40585135 missense probably damaging 1.00
IGL01405:Slc22a16 APN 10 40585195 missense probably benign 0.36
IGL01667:Slc22a16 APN 10 40585018 missense probably damaging 1.00
IGL01700:Slc22a16 APN 10 40603908 missense unknown
IGL01792:Slc22a16 APN 10 40573932 missense possibly damaging 0.51
IGL02948:Slc22a16 APN 10 40573962 nonsense probably null
IGL03178:Slc22a16 APN 10 40573760 missense probably benign 0.09
PIT4418001:Slc22a16 UTSW 10 40603825 missense unknown
R0358:Slc22a16 UTSW 10 40587492 splice site probably null
R0422:Slc22a16 UTSW 10 40591890 missense probably damaging 1.00
R0497:Slc22a16 UTSW 10 40584967 missense probably damaging 1.00
R1435:Slc22a16 UTSW 10 40587607 missense probably damaging 1.00
R1577:Slc22a16 UTSW 10 40603815 nonsense probably null
R1696:Slc22a16 UTSW 10 40584927 missense possibly damaging 0.75
R2022:Slc22a16 UTSW 10 40591877 missense probably damaging 1.00
R2065:Slc22a16 UTSW 10 40585020 missense possibly damaging 0.63
R2082:Slc22a16 UTSW 10 40585339 missense probably benign 0.02
R4588:Slc22a16 UTSW 10 40570681 intron probably benign
R4828:Slc22a16 UTSW 10 40573640 missense probably damaging 1.00
R4853:Slc22a16 UTSW 10 40574051 missense probably damaging 0.98
R5127:Slc22a16 UTSW 10 40573957 missense probably benign 0.21
R5215:Slc22a16 UTSW 10 40581390 missense probably damaging 1.00
R5590:Slc22a16 UTSW 10 40581341 missense possibly damaging 0.94
R5626:Slc22a16 UTSW 10 40584853 critical splice acceptor site probably null
R5810:Slc22a16 UTSW 10 40595318 missense possibly damaging 0.86
R6675:Slc22a16 UTSW 10 40573840 nonsense probably null
R6692:Slc22a16 UTSW 10 40603905 missense unknown
R6738:Slc22a16 UTSW 10 40585302 missense probably damaging 0.99
R7158:Slc22a16 UTSW 10 40573741 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CTGGGAACTCACGAGATGTAG -3'
(R):5'- ACTGTGTTACTCTGCGTGCC -3'

Sequencing Primer
(F):5'- GAGAACACGTCACATTTGGGCTATG -3'
(R):5'- CTGCGTGCCTAACTGATGGATC -3'
Posted On2015-05-15