Incidental Mutation 'R4097:Sgpl1'
ID317175
Institutional Source Beutler Lab
Gene Symbol Sgpl1
Ensembl Gene ENSMUSG00000020097
Gene Namesphingosine phosphate lyase 1
SynonymsD10Xrf456
MMRRC Submission 040984-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.609) question?
Stock #R4097 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location61098642-61147703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61103238 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 394 (G394D)
Ref Sequence ENSEMBL: ENSMUSP00000117848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092498] [ENSMUST00000122259] [ENSMUST00000150258]
Predicted Effect probably damaging
Transcript: ENSMUST00000092498
AA Change: G394D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090155
Gene: ENSMUSG00000020097
AA Change: G394D

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
Pfam:Pyridoxal_deC 159 454 7.8e-21 PFAM
Pfam:Aminotran_1_2 169 326 3.3e-10 PFAM
Pfam:Aminotran_5 187 472 3.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122259
AA Change: G394D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112975
Gene: ENSMUSG00000020097
AA Change: G394D

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
Pfam:Pyridoxal_deC 168 454 4.1e-23 PFAM
Pfam:Aminotran_1_2 169 326 3.3e-10 PFAM
Pfam:Aminotran_5 186 472 5.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143225
Predicted Effect probably damaging
Transcript: ENSMUST00000150258
AA Change: G394D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117848
Gene: ENSMUSG00000020097
AA Change: G394D

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
Pfam:Pyridoxal_deC 167 454 2.6e-23 PFAM
Pfam:Aminotran_1_2 169 326 7.9e-10 PFAM
Pfam:Aminotran_5 187 471 1.1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152316
Meta Mutation Damage Score 0.47 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit premature death, skeletal and craniofacial defects, kidney defects, hematopoietic defects, decreased body weight and abnormal cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,512,364 F292L probably damaging Het
Ankrd36 A G 11: 5,628,703 D664G possibly damaging Het
Bbs1 T A 19: 4,897,317 Y358F probably damaging Het
Becn1 C T 11: 101,294,266 probably benign Het
Cenpp A T 13: 49,493,789 N47I possibly damaging Het
Clec4n A T 6: 123,230,741 H55L possibly damaging Het
Cntnap4 A G 8: 112,752,307 I222V probably benign Het
Cttnbp2 T C 6: 18,420,872 E370G probably benign Het
Cyp4a10 T A 4: 115,529,283 V413E probably damaging Het
Dctn2 C T 10: 127,277,493 L249F probably damaging Het
Dnah9 T C 11: 65,990,459 S146G probably damaging Het
Dzip3 A T 16: 48,958,489 L315* probably null Het
Evpl T C 11: 116,223,177 E1229G possibly damaging Het
Ice2 T C 9: 69,421,671 V775A possibly damaging Het
Jmjd1c A G 10: 67,219,008 E69G probably benign Het
Lrrc66 T A 5: 73,607,704 R665S possibly damaging Het
Mpdz T A 4: 81,335,700 H1065L probably damaging Het
Nrf1 C T 6: 30,151,672 Q503* probably null Het
Nt5dc3 G A 10: 86,833,956 A472T probably benign Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Pramel6 T G 2: 87,509,353 F154V probably benign Het
Ralb T C 1: 119,483,498 D37G probably benign Het
Ranbp9 A T 13: 43,421,257 Y412N probably damaging Het
Scg2 T A 1: 79,435,821 D395V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpine3 T A 14: 62,670,946 L141Q probably damaging Het
Sh3pxd2a T C 19: 47,424,512 Y44C probably damaging Het
Slc6a20b A G 9: 123,612,757 probably benign Het
Snapc5 T C 9: 64,180,527 I40T probably damaging Het
Spopl T C 2: 23,511,401 H365R probably benign Het
Stil T A 4: 115,023,600 I447N probably benign Het
Taf3 C A 2: 9,952,367 V330F possibly damaging Het
Tgoln1 T C 6: 72,615,801 E232G probably damaging Het
Thrap3 A G 4: 126,171,802 L729P probably damaging Het
Tmem269 A T 4: 119,205,780 F220Y probably damaging Het
Tnrc18 ATCTTCC A 5: 142,773,806 probably benign Het
Ubxn6 T C 17: 56,069,712 T227A probably benign Het
Wdr17 C A 8: 54,635,469 R1182I probably damaging Het
Wdr26 T C 1: 181,182,787 I550V probably benign Het
Wdr43 A G 17: 71,657,537 N637S probably benign Het
Zfp516 A G 18: 82,987,256 T762A possibly damaging Het
Other mutations in Sgpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Sgpl1 APN 10 61100908 missense probably benign 0.00
IGL01376:Sgpl1 APN 10 61114070 missense probably damaging 1.00
IGL01954:Sgpl1 APN 10 61100893 missense probably benign 0.00
IGL02668:Sgpl1 APN 10 61105450 missense probably damaging 0.97
IGL02797:Sgpl1 APN 10 61101728 missense probably benign 0.01
R0034:Sgpl1 UTSW 10 61102613 missense probably damaging 0.97
R0309:Sgpl1 UTSW 10 61113437 critical splice donor site probably null
R0647:Sgpl1 UTSW 10 61113488 missense probably damaging 1.00
R1496:Sgpl1 UTSW 10 61102589 missense probably damaging 1.00
R1603:Sgpl1 UTSW 10 61105451 missense possibly damaging 0.95
R1941:Sgpl1 UTSW 10 61103307 missense probably damaging 1.00
R4392:Sgpl1 UTSW 10 61104452 splice site probably benign
R4798:Sgpl1 UTSW 10 61123344 missense possibly damaging 0.83
R4849:Sgpl1 UTSW 10 61104518 missense probably benign 0.00
R4882:Sgpl1 UTSW 10 61112265 missense probably damaging 1.00
R4962:Sgpl1 UTSW 10 61114084 missense probably damaging 1.00
R6395:Sgpl1 UTSW 10 61112157 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCAGGAGACAGTAGGGCTC -3'
(R):5'- GAAAGCCGCATTACCTTGATG -3'

Sequencing Primer
(F):5'- GCTCAAAGGGTGTGCCAC -3'
(R):5'- CCTTGATGGTTCTGTGGGCAG -3'
Posted On2015-05-15