Incidental Mutation 'R4097:Ankrd36'
ID317180
Institutional Source Beutler Lab
Gene Symbol Ankrd36
Ensembl Gene ENSMUSG00000020481
Gene Nameankyrin repeat domain 36
Synonyms1700012M14Rik, 1700008J08Rik, GC3
MMRRC Submission 040984-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.020) question?
Stock #R4097 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5569684-5689337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5628703 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 664 (D664G)
Ref Sequence ENSEMBL: ENSMUSP00000122397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109856] [ENSMUST00000118112] [ENSMUST00000137933]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109856
AA Change: D632G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105482
Gene: ENSMUSG00000020481
AA Change: D632G

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 4.5e-3 SMART
ANK 99 128 1.44e-1 SMART
ANK 132 161 4.6e0 SMART
ANK 165 194 2.48e-5 SMART
ANK 198 227 4.67e-1 SMART
internal_repeat_1 449 555 1.04e-5 PROSPERO
internal_repeat_1 891 981 1.04e-5 PROSPERO
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1268 1297 N/A INTRINSIC
coiled coil region 1318 1338 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118112
AA Change: D664G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122397
Gene: ENSMUSG00000020481
AA Change: D664G

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 2.9e-5 SMART
ANK 99 128 9.4e-4 SMART
ANK 132 161 2.9e-2 SMART
ANK 165 194 1.5e-7 SMART
ANK 198 227 2.9e-3 SMART
internal_repeat_1 255 352 8.15e-5 PROSPERO
internal_repeat_1 438 538 8.15e-5 PROSPERO
low complexity region 1138 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137933
SMART Domains Protein: ENSMUSP00000120499
Gene: ENSMUSG00000020481

DomainStartEndE-ValueType
low complexity region 463 476 N/A INTRINSIC
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,512,364 F292L probably damaging Het
Bbs1 T A 19: 4,897,317 Y358F probably damaging Het
Becn1 C T 11: 101,294,266 probably benign Het
Cenpp A T 13: 49,493,789 N47I possibly damaging Het
Clec4n A T 6: 123,230,741 H55L possibly damaging Het
Cntnap4 A G 8: 112,752,307 I222V probably benign Het
Cttnbp2 T C 6: 18,420,872 E370G probably benign Het
Cyp4a10 T A 4: 115,529,283 V413E probably damaging Het
Dctn2 C T 10: 127,277,493 L249F probably damaging Het
Dnah9 T C 11: 65,990,459 S146G probably damaging Het
Dzip3 A T 16: 48,958,489 L315* probably null Het
Evpl T C 11: 116,223,177 E1229G possibly damaging Het
Ice2 T C 9: 69,421,671 V775A possibly damaging Het
Jmjd1c A G 10: 67,219,008 E69G probably benign Het
Lrrc66 T A 5: 73,607,704 R665S possibly damaging Het
Mpdz T A 4: 81,335,700 H1065L probably damaging Het
Nrf1 C T 6: 30,151,672 Q503* probably null Het
Nt5dc3 G A 10: 86,833,956 A472T probably benign Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Pramel6 T G 2: 87,509,353 F154V probably benign Het
Ralb T C 1: 119,483,498 D37G probably benign Het
Ranbp9 A T 13: 43,421,257 Y412N probably damaging Het
Scg2 T A 1: 79,435,821 D395V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpine3 T A 14: 62,670,946 L141Q probably damaging Het
Sgpl1 C T 10: 61,103,238 G394D probably damaging Het
Sh3pxd2a T C 19: 47,424,512 Y44C probably damaging Het
Slc6a20b A G 9: 123,612,757 probably benign Het
Snapc5 T C 9: 64,180,527 I40T probably damaging Het
Spopl T C 2: 23,511,401 H365R probably benign Het
Stil T A 4: 115,023,600 I447N probably benign Het
Taf3 C A 2: 9,952,367 V330F possibly damaging Het
Tgoln1 T C 6: 72,615,801 E232G probably damaging Het
Thrap3 A G 4: 126,171,802 L729P probably damaging Het
Tmem269 A T 4: 119,205,780 F220Y probably damaging Het
Tnrc18 ATCTTCC A 5: 142,773,806 probably benign Het
Ubxn6 T C 17: 56,069,712 T227A probably benign Het
Wdr17 C A 8: 54,635,469 R1182I probably damaging Het
Wdr26 T C 1: 181,182,787 I550V probably benign Het
Wdr43 A G 17: 71,657,537 N637S probably benign Het
Zfp516 A G 18: 82,987,256 T762A possibly damaging Het
Other mutations in Ankrd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ankrd36 APN 11 5620131 missense probably benign 0.01
IGL01361:Ankrd36 APN 11 5596706 splice site probably benign
IGL01370:Ankrd36 APN 11 5584019 missense probably benign 0.06
IGL01384:Ankrd36 APN 11 5628348 missense probably benign 0.33
IGL01484:Ankrd36 APN 11 5629006 missense possibly damaging 0.90
IGL01524:Ankrd36 APN 11 5635092 missense probably benign
IGL01700:Ankrd36 APN 11 5632198 missense probably benign 0.05
IGL02322:Ankrd36 APN 11 5614619 missense possibly damaging 0.86
IGL02511:Ankrd36 APN 11 5660845 unclassified probably null
IGL02824:Ankrd36 APN 11 5574246 missense possibly damaging 0.67
IGL03204:Ankrd36 APN 11 5584023 missense possibly damaging 0.70
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0304:Ankrd36 UTSW 11 5628981 missense possibly damaging 0.55
R0504:Ankrd36 UTSW 11 5629274 missense probably damaging 0.99
R0550:Ankrd36 UTSW 11 5607429 critical splice donor site probably null
R0563:Ankrd36 UTSW 11 5629322 missense probably benign 0.33
R0891:Ankrd36 UTSW 11 5687316 missense possibly damaging 0.72
R1018:Ankrd36 UTSW 11 5646876 unclassified probably benign
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1558:Ankrd36 UTSW 11 5635329 missense probably damaging 0.99
R1663:Ankrd36 UTSW 11 5620126 missense possibly damaging 0.70
R1682:Ankrd36 UTSW 11 5607143 missense possibly damaging 0.84
R1898:Ankrd36 UTSW 11 5575683 missense probably benign 0.33
R2019:Ankrd36 UTSW 11 5689140 missense probably benign
R2032:Ankrd36 UTSW 11 5628616 missense possibly damaging 0.86
R2084:Ankrd36 UTSW 11 5662378 nonsense probably null
R4572:Ankrd36 UTSW 11 5689340 unclassified probably null
R4601:Ankrd36 UTSW 11 5570102 missense probably benign 0.04
R4770:Ankrd36 UTSW 11 5590870 missense possibly damaging 0.73
R4777:Ankrd36 UTSW 11 5607120 missense probably benign
R4894:Ankrd36 UTSW 11 5635332 missense probably damaging 0.98
R5288:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5366:Ankrd36 UTSW 11 5592841 nonsense probably null
R5384:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5385:Ankrd36 UTSW 11 5689340 unclassified probably benign
R6109:Ankrd36 UTSW 11 5628941 missense probably damaging 0.98
R6155:Ankrd36 UTSW 11 5687442 missense probably benign 0.00
R6186:Ankrd36 UTSW 11 5643812 missense possibly damaging 0.81
R6289:Ankrd36 UTSW 11 5628837 missense probably damaging 0.96
R6476:Ankrd36 UTSW 11 5628753 missense probably benign 0.05
R6816:Ankrd36 UTSW 11 5643765 missense possibly damaging 0.66
R6880:Ankrd36 UTSW 11 5628748 missense probably damaging 0.99
R6919:Ankrd36 UTSW 11 5629299 missense probably benign
U24488:Ankrd36 UTSW 11 5630772 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCGCTAAGGGCCAAATACTTG -3'
(R):5'- AAAAGATTCTCCCAATTCAGATGCG -3'

Sequencing Primer
(F):5'- TACTTGGGGGAAAGTTGACATTAG -3'
(R):5'- TCAGATGCGTTATTTTCACAGTC -3'
Posted On2015-05-15