Incidental Mutation 'R4097:Cenpp'
ID317185
Institutional Source Beutler Lab
Gene Symbol Cenpp
Ensembl Gene ENSMUSG00000021391
Gene Namecentromere protein P
Synonyms1700022C02Rik, 4921518G09Rik
MMRRC Submission 040984-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R4097 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49464023-49652785 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49493789 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 47 (N47I)
Ref Sequence ENSEMBL: ENSMUSP00000152773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000222404]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178840
Predicted Effect possibly damaging
Transcript: ENSMUST00000222404
AA Change: N47I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CENPP is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,512,364 F292L probably damaging Het
Ankrd36 A G 11: 5,628,703 D664G possibly damaging Het
Bbs1 T A 19: 4,897,317 Y358F probably damaging Het
Becn1 C T 11: 101,294,266 probably benign Het
Clec4n A T 6: 123,230,741 H55L possibly damaging Het
Cntnap4 A G 8: 112,752,307 I222V probably benign Het
Cttnbp2 T C 6: 18,420,872 E370G probably benign Het
Cyp4a10 T A 4: 115,529,283 V413E probably damaging Het
Dctn2 C T 10: 127,277,493 L249F probably damaging Het
Dnah9 T C 11: 65,990,459 S146G probably damaging Het
Dzip3 A T 16: 48,958,489 L315* probably null Het
Evpl T C 11: 116,223,177 E1229G possibly damaging Het
Ice2 T C 9: 69,421,671 V775A possibly damaging Het
Jmjd1c A G 10: 67,219,008 E69G probably benign Het
Lrrc66 T A 5: 73,607,704 R665S possibly damaging Het
Mpdz T A 4: 81,335,700 H1065L probably damaging Het
Nrf1 C T 6: 30,151,672 Q503* probably null Het
Nt5dc3 G A 10: 86,833,956 A472T probably benign Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Pramel6 T G 2: 87,509,353 F154V probably benign Het
Ralb T C 1: 119,483,498 D37G probably benign Het
Ranbp9 A T 13: 43,421,257 Y412N probably damaging Het
Scg2 T A 1: 79,435,821 D395V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpine3 T A 14: 62,670,946 L141Q probably damaging Het
Sgpl1 C T 10: 61,103,238 G394D probably damaging Het
Sh3pxd2a T C 19: 47,424,512 Y44C probably damaging Het
Slc6a20b A G 9: 123,612,757 probably benign Het
Snapc5 T C 9: 64,180,527 I40T probably damaging Het
Spopl T C 2: 23,511,401 H365R probably benign Het
Stil T A 4: 115,023,600 I447N probably benign Het
Taf3 C A 2: 9,952,367 V330F possibly damaging Het
Tgoln1 T C 6: 72,615,801 E232G probably damaging Het
Thrap3 A G 4: 126,171,802 L729P probably damaging Het
Tmem269 A T 4: 119,205,780 F220Y probably damaging Het
Tnrc18 ATCTTCC A 5: 142,773,806 probably benign Het
Ubxn6 T C 17: 56,069,712 T227A probably benign Het
Wdr17 C A 8: 54,635,469 R1182I probably damaging Het
Wdr26 T C 1: 181,182,787 I550V probably benign Het
Wdr43 A G 17: 71,657,537 N637S probably benign Het
Zfp516 A G 18: 82,987,256 T762A possibly damaging Het
Other mutations in Cenpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Cenpp APN 13 49647656 critical splice acceptor site probably null
IGL01323:Cenpp APN 13 49647642 missense probably damaging 1.00
IGL01397:Cenpp APN 13 49641283 missense probably damaging 1.00
IGL01553:Cenpp APN 13 49464776 missense probably damaging 0.99
IGL02489:Cenpp APN 13 49650118 splice site probably null
IGL03024:Cenpp APN 13 49464254 missense probably benign 0.16
R0218:Cenpp UTSW 13 49647632 missense possibly damaging 0.57
R0660:Cenpp UTSW 13 49464697 missense probably benign 0.00
R1868:Cenpp UTSW 13 49641283 missense probably damaging 1.00
R4377:Cenpp UTSW 13 49494431 utr 3 prime probably benign
R4595:Cenpp UTSW 13 49641234 missense probably benign 0.09
R5173:Cenpp UTSW 13 49464782 frame shift probably null
R5174:Cenpp UTSW 13 49464782 frame shift probably null
R5953:Cenpp UTSW 13 49652685 missense probably damaging 0.99
Z1088:Cenpp UTSW 13 49647658 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGTGACAAGGATCAGGC -3'
(R):5'- AACACACTGATGCTGGCTGG -3'

Sequencing Primer
(F):5'- AGGCAAGTACCTGATTCTGC -3'
(R):5'- GATCGAGGGCCAGATCATCAC -3'
Posted On2015-05-15