Incidental Mutation 'R4097:Dzip3'
ID317187
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission 040984-MU
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4097 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 48958489 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 315 (L315*)
Ref Sequence ENSEMBL: ENSMUSP00000113344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect probably null
Transcript: ENSMUST00000114516
AA Change: L315*
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061
AA Change: L315*

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121869
AA Change: L315*
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: L315*

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133377
Meta Mutation Damage Score 0.536 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,512,364 F292L probably damaging Het
Ankrd36 A G 11: 5,628,703 D664G possibly damaging Het
Bbs1 T A 19: 4,897,317 Y358F probably damaging Het
Becn1 C T 11: 101,294,266 probably benign Het
Cenpp A T 13: 49,493,789 N47I possibly damaging Het
Clec4n A T 6: 123,230,741 H55L possibly damaging Het
Cntnap4 A G 8: 112,752,307 I222V probably benign Het
Cttnbp2 T C 6: 18,420,872 E370G probably benign Het
Cyp4a10 T A 4: 115,529,283 V413E probably damaging Het
Dctn2 C T 10: 127,277,493 L249F probably damaging Het
Dnah9 T C 11: 65,990,459 S146G probably damaging Het
Evpl T C 11: 116,223,177 E1229G possibly damaging Het
Ice2 T C 9: 69,421,671 V775A possibly damaging Het
Jmjd1c A G 10: 67,219,008 E69G probably benign Het
Lrrc66 T A 5: 73,607,704 R665S possibly damaging Het
Mpdz T A 4: 81,335,700 H1065L probably damaging Het
Nrf1 C T 6: 30,151,672 Q503* probably null Het
Nt5dc3 G A 10: 86,833,956 A472T probably benign Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Pramel6 T G 2: 87,509,353 F154V probably benign Het
Ralb T C 1: 119,483,498 D37G probably benign Het
Ranbp9 A T 13: 43,421,257 Y412N probably damaging Het
Scg2 T A 1: 79,435,821 D395V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpine3 T A 14: 62,670,946 L141Q probably damaging Het
Sgpl1 C T 10: 61,103,238 G394D probably damaging Het
Sh3pxd2a T C 19: 47,424,512 Y44C probably damaging Het
Slc6a20b A G 9: 123,612,757 probably benign Het
Snapc5 T C 9: 64,180,527 I40T probably damaging Het
Spopl T C 2: 23,511,401 H365R probably benign Het
Stil T A 4: 115,023,600 I447N probably benign Het
Taf3 C A 2: 9,952,367 V330F possibly damaging Het
Tgoln1 T C 6: 72,615,801 E232G probably damaging Het
Thrap3 A G 4: 126,171,802 L729P probably damaging Het
Tmem269 A T 4: 119,205,780 F220Y probably damaging Het
Tnrc18 ATCTTCC A 5: 142,773,806 probably benign Het
Ubxn6 T C 17: 56,069,712 T227A probably benign Het
Wdr17 C A 8: 54,635,469 R1182I probably damaging Het
Wdr26 T C 1: 181,182,787 I550V probably benign Het
Wdr43 A G 17: 71,657,537 N637S probably benign Het
Zfp516 A G 18: 82,987,256 T762A possibly damaging Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0927:Dzip3 UTSW 16 48975477 missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48951681 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1526:Dzip3 UTSW 16 48937006 missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R1957:Dzip3 UTSW 16 48927593 missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48972218 splice site probably null
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4371:Dzip3 UTSW 16 48943455 critical splice donor site probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48925969 unclassified probably benign
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CATCATTAGACAGGCATTAGGAAG -3'
(R):5'- AGGTCCTTAGAGAGTGTGAAGTC -3'

Sequencing Primer
(F):5'- ACAAGGCCCTTGATTTAACTCTCAGG -3'
(R):5'- GATCTGAGAAATCTGTCAGTAACTG -3'
Posted On2015-05-15