Incidental Mutation 'R4109:Acads'
List |< first << previous [record 31 of 958] next >> last >|
ID317204
Institutional Source Beutler Lab
Gene Symbol Acads
Ensembl Gene ENSMUSG00000029545
Gene Nameacyl-Coenzyme A dehydrogenase, short chain
SynonymsBcd-1, Hdlq8, Bcd1, SCAD
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R4109 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115110299-115119346 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 115110854 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 302 (*302W)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031524]
Predicted Effect probably null
Transcript: ENSMUST00000031524
AA Change: *413W
SMART Domains Protein: ENSMUSP00000031524
Gene: ENSMUSG00000029545
AA Change: *413W

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 35 147 1e-37 PFAM
Pfam:Acyl-CoA_dh_M 151 246 6.1e-28 PFAM
Pfam:Acyl-CoA_dh_1 258 407 3.6e-52 PFAM
Pfam:Acyl-CoA_dh_2 273 396 6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141142
Predicted Effect probably null
Transcript: ENSMUST00000150291
AA Change: *302W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201888
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homotetrameric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the Acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum at C(four)-CoA. In mice, deficiency of this gene has been linked to cold sensitivity and increased high-density lipoprotein levels. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display organic aciduria and develop hypoglycemia and fatty livers after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik A T 9: 124,295,103 D59E probably benign Het
Aldh1l1 A G 6: 90,562,644 E185G probably benign Het
Arhgap20 A G 9: 51,816,685 H66R possibly damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Atg2a A G 19: 6,258,374 T1646A possibly damaging Het
Cd200r1 C G 16: 44,790,084 T185S possibly damaging Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Col1a2 A T 6: 4,510,705 R52* probably null Het
Eml5 T C 12: 98,841,548 probably null Het
Ifi206 T G 1: 173,480,988 T481P probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Nos1ap A T 1: 170,318,668 M439K probably benign Het
Paxbp1 T A 16: 91,016,898 T864S probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Satb1 A G 17: 51,804,350 V160A probably damaging Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 probably benign Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc1a7 T C 4: 107,968,661 V39A probably benign Het
Spire1 T C 18: 67,497,217 Q338R probably damaging Het
Supt16 T C 14: 52,162,731 E985G probably damaging Het
Tmprss11f T C 5: 86,529,936 K325E possibly damaging Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trav13-2 A C 14: 53,635,241 H58P probably benign Het
Trbv13-2 A T 6: 41,121,644 Y51F probably benign Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Zan G A 5: 137,458,619 T1285I unknown Het
Other mutations in Acads
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02325:Acads APN 5 115111954 missense probably damaging 1.00
IGL02650:Acads APN 5 115112815 missense probably benign 0.17
R1871:Acads UTSW 5 115117642 missense probably damaging 0.99
R3110:Acads UTSW 5 115117698 missense probably benign
R3112:Acads UTSW 5 115117698 missense probably benign
R4595:Acads UTSW 5 115113064 missense probably damaging 1.00
R4799:Acads UTSW 5 115113090 missense probably benign 0.41
R6841:Acads UTSW 5 115112358 missense probably benign 0.03
R6932:Acads UTSW 5 115112272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTGATTTCTTCTCGGTTGCAG -3'
(R):5'- GGGGCTTCTCTCTTAGTACCTG -3'

Sequencing Primer
(F):5'- TTGCAGGTCACAGCATCTG -3'
(R):5'- AGTACCTGTTTTCCCCTCTCAG -3'
Posted On2015-05-15