Incidental Mutation 'R4109:2010315B03Rik'
ID317212
Institutional Source Beutler Lab
Gene Symbol 2010315B03Rik
Ensembl Gene ENSMUSG00000074829
Gene NameRIKEN cDNA 2010315B03 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4109 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location124291804-124312696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124295103 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 59 (D59E)
Ref Sequence ENSEMBL: ENSMUSP00000140738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071300] [ENSMUST00000177714] [ENSMUST00000185949] [ENSMUST00000189915]
Predicted Effect probably benign
Transcript: ENSMUST00000071300
AA Change: D83E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071269
Gene: ENSMUSG00000074829
AA Change: D83E

DomainStartEndE-ValueType
KRAB 24 86 5.28e-14 SMART
ZnF_C2H2 95 117 5.9e-3 SMART
ZnF_C2H2 123 145 1.26e-2 SMART
ZnF_C2H2 151 173 2.95e-3 SMART
ZnF_C2H2 179 201 4.24e-4 SMART
ZnF_C2H2 207 229 1.38e-3 SMART
ZnF_C2H2 235 257 3.21e-4 SMART
ZnF_C2H2 263 285 1.26e-2 SMART
ZnF_C2H2 291 312 6.08e0 SMART
ZnF_C2H2 318 340 8.6e-5 SMART
ZnF_C2H2 346 368 1.36e-2 SMART
ZnF_C2H2 374 396 8.02e-5 SMART
ZnF_C2H2 402 424 9.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177714
AA Change: D62E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000137258
Gene: ENSMUSG00000074829
AA Change: D62E

DomainStartEndE-ValueType
KRAB 28 90 5.28e-14 SMART
ZnF_C2H2 99 121 5.9e-3 SMART
ZnF_C2H2 127 149 1.26e-2 SMART
ZnF_C2H2 155 177 2.95e-3 SMART
ZnF_C2H2 183 205 4.24e-4 SMART
ZnF_C2H2 211 233 1.38e-3 SMART
ZnF_C2H2 239 261 3.21e-4 SMART
ZnF_C2H2 267 289 1.26e-2 SMART
ZnF_C2H2 295 316 6.08e0 SMART
ZnF_C2H2 322 344 8.6e-5 SMART
ZnF_C2H2 350 372 1.36e-2 SMART
ZnF_C2H2 378 400 8.02e-5 SMART
ZnF_C2H2 406 428 9.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185949
AA Change: D87E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140144
Gene: ENSMUSG00000074829
AA Change: D87E

DomainStartEndE-ValueType
KRAB 29 91 2.3e-16 SMART
ZnF_C2H2 100 122 2.5e-5 SMART
ZnF_C2H2 128 150 5.3e-5 SMART
ZnF_C2H2 156 175 5.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189915
AA Change: D59E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140738
Gene: ENSMUSG00000074829
AA Change: D59E

DomainStartEndE-ValueType
KRAB 1 63 2.3e-16 SMART
ZnF_C2H2 72 94 2.5e-5 SMART
ZnF_C2H2 100 122 5.3e-5 SMART
ZnF_C2H2 128 150 1.2e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads T C 5: 115,110,854 *302W probably null Het
Aldh1l1 A G 6: 90,562,644 E185G probably benign Het
Arhgap20 A G 9: 51,816,685 H66R possibly damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Atg2a A G 19: 6,258,374 T1646A possibly damaging Het
Cd200r1 C G 16: 44,790,084 T185S possibly damaging Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Col1a2 A T 6: 4,510,705 R52* probably null Het
Eml5 T C 12: 98,841,548 probably null Het
Ifi206 T G 1: 173,480,988 T481P probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Nos1ap A T 1: 170,318,668 M439K probably benign Het
Paxbp1 T A 16: 91,016,898 T864S probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Satb1 A G 17: 51,804,350 V160A probably damaging Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 probably benign Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc1a7 T C 4: 107,968,661 V39A probably benign Het
Spire1 T C 18: 67,497,217 Q338R probably damaging Het
Supt16 T C 14: 52,162,731 E985G probably damaging Het
Tmprss11f T C 5: 86,529,936 K325E possibly damaging Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trav13-2 A C 14: 53,635,241 H58P probably benign Het
Trbv13-2 A T 6: 41,121,644 Y51F probably benign Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Zan G A 5: 137,458,619 T1285I unknown Het
Other mutations in 2010315B03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:2010315B03Rik APN 9 124295490 splice site probably benign
P4748:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0090:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0122:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0140:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0164:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0164:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0388:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0775:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0798:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R1467:2010315B03Rik UTSW 9 124295463 missense possibly damaging 0.91
R1569:2010315B03Rik UTSW 9 124293797 nonsense probably null
R2566:2010315B03Rik UTSW 9 124293071 missense probably damaging 0.97
R2566:2010315B03Rik UTSW 9 124293153 missense probably damaging 0.99
R3853:2010315B03Rik UTSW 9 124293346 missense probably damaging 1.00
R4092:2010315B03Rik UTSW 9 124293273 missense probably benign 0.03
R4646:2010315B03Rik UTSW 9 124293598 missense probably benign 0.00
R4648:2010315B03Rik UTSW 9 124293598 missense probably benign 0.00
R4705:2010315B03Rik UTSW 9 124294001 missense possibly damaging 0.86
R4764:2010315B03Rik UTSW 9 124293766 missense probably benign 0.01
R5110:2010315B03Rik UTSW 9 124295357 critical splice donor site probably null
R5117:2010315B03Rik UTSW 9 124293085 missense probably benign 0.00
R5162:2010315B03Rik UTSW 9 124293671 missense probably benign 0.08
R5226:2010315B03Rik UTSW 9 124294076 missense possibly damaging 0.91
R5426:2010315B03Rik UTSW 9 124294003 missense probably damaging 1.00
R6793:2010315B03Rik UTSW 9 124295422 missense possibly damaging 0.85
R6975:2010315B03Rik UTSW 9 124294057 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTCTAATAGGGCTGTGATTCAAATGG -3'
(R):5'- TTGCTGAATCCTTCCCAGAAG -3'

Sequencing Primer
(F):5'- CCAGACAGCTGACATTGAGGTAC -3'
(R):5'- CGAGAACCTCACTGCTATAGGTAAG -3'
Posted On2015-05-15