Incidental Mutation 'R4110:Pign'
ID317226
Institutional Source Beutler Lab
Gene Symbol Pign
Ensembl Gene ENSMUSG00000056536
Gene Namephosphatidylinositol glycan anchor biosynthesis, class N
Synonyms
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.744) question?
Stock #R4110 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location105518422-105663677 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 105553815 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070699] [ENSMUST00000186485] [ENSMUST00000187537] [ENSMUST00000190811]
Predicted Effect probably benign
Transcript: ENSMUST00000070699
SMART Domains Protein: ENSMUSP00000069969
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 116 303 1.2e-10 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 2.3e-138 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186485
SMART Domains Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 109 330 3.7e-11 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 1.5e-141 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000187537
AA Change: S819P
SMART Domains Protein: ENSMUSP00000140020
Gene: ENSMUSG00000056536
AA Change: S819P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.2e-12 PFAM
Pfam:Sulfatase 146 334 2.9e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 800 5.9e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190139
Predicted Effect probably benign
Transcript: ENSMUST00000190811
SMART Domains Protein: ENSMUSP00000140844
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.1e-12 PFAM
Pfam:Sulfatase 146 334 2.8e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 794 4.4e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190945
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal gastrulation, forebrain hypoplasia, coloboma, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Pign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Pign APN 1 105597723 nonsense probably null
IGL00770:Pign APN 1 105597756 missense probably benign 0.00
IGL00774:Pign APN 1 105597756 missense probably benign 0.00
IGL00828:Pign APN 1 105554120 missense probably damaging 0.97
IGL01407:Pign APN 1 105589302 missense probably benign 0.06
IGL01523:Pign APN 1 105653178 missense probably damaging 0.98
IGL01953:Pign APN 1 105589039 splice site probably benign
IGL02389:Pign APN 1 105646781 nonsense probably null
PIT4810001:Pign UTSW 1 105597762 missense possibly damaging 0.83
R0080:Pign UTSW 1 105552405 missense probably damaging 1.00
R0097:Pign UTSW 1 105587976 splice site probably benign
R0302:Pign UTSW 1 105589093 missense possibly damaging 0.83
R0573:Pign UTSW 1 105653177 missense probably damaging 1.00
R0580:Pign UTSW 1 105591694 missense probably benign 0.03
R0946:Pign UTSW 1 105591697 missense probably benign 0.00
R1397:Pign UTSW 1 105657771 missense probably damaging 1.00
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1751:Pign UTSW 1 105653192 missense probably benign 0.19
R1753:Pign UTSW 1 105589317 missense possibly damaging 0.65
R1767:Pign UTSW 1 105653192 missense probably benign 0.19
R1854:Pign UTSW 1 105554498 missense probably damaging 0.99
R1907:Pign UTSW 1 105638215 missense possibly damaging 0.50
R2845:Pign UTSW 1 105657796 missense possibly damaging 0.80
R2846:Pign UTSW 1 105657796 missense possibly damaging 0.80
R3718:Pign UTSW 1 105649281 critical splice donor site probably null
R3970:Pign UTSW 1 105656003 missense probably damaging 1.00
R4067:Pign UTSW 1 105587978 critical splice donor site probably null
R4387:Pign UTSW 1 105522060 missense possibly damaging 0.48
R4393:Pign UTSW 1 105522026 missense probably benign 0.00
R4472:Pign UTSW 1 105648220 missense probably benign 0.29
R4519:Pign UTSW 1 105597666 critical splice donor site probably null
R4619:Pign UTSW 1 105521990 utr 3 prime probably benign
R4746:Pign UTSW 1 105585024 missense probably benign 0.33
R4859:Pign UTSW 1 105648167 nonsense probably null
R4893:Pign UTSW 1 105646711 missense probably damaging 1.00
R4953:Pign UTSW 1 105644502 missense probably benign 0.32
R5046:Pign UTSW 1 105522073 missense possibly damaging 0.94
R5377:Pign UTSW 1 105657812 missense probably benign 0.12
R5388:Pign UTSW 1 105655970 missense probably damaging 1.00
R5482:Pign UTSW 1 105546710 missense probably benign 0.44
R5594:Pign UTSW 1 105646869 intron probably benign
R5639:Pign UTSW 1 105589315 missense probably benign 0.09
R5778:Pign UTSW 1 105591722 missense probably damaging 1.00
R5821:Pign UTSW 1 105589063 missense possibly damaging 0.95
R5928:Pign UTSW 1 105558067 missense possibly damaging 0.55
R5979:Pign UTSW 1 105589274 missense probably benign 0.01
R6213:Pign UTSW 1 105589266 missense possibly damaging 0.50
R6292:Pign UTSW 1 105585077 missense possibly damaging 0.69
R6343:Pign UTSW 1 105585095 missense probably benign 0.33
R6566:Pign UTSW 1 105638181 critical splice donor site probably null
R6856:Pign UTSW 1 105553895 nonsense probably null
R6954:Pign UTSW 1 105553897 missense probably benign 0.39
X0025:Pign UTSW 1 105657634 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAAAGACAGTGAACTTTATCCCAC -3'
(R):5'- ACGTGTGGTGTTAAGATTGTAAAGC -3'

Sequencing Primer
(F):5'- TAGCATAAACACTAAGCTGGTGC -3'
(R):5'- GCCATTGTCATTGTAACAGAGATAG -3'
Posted On2015-05-15