Incidental Mutation 'R4110:Hhipl2'
ID317228
Institutional Source Beutler Lab
Gene Symbol Hhipl2
Ensembl Gene ENSMUSG00000053461
Gene Namehedgehog interacting protein-like 2
Synonyms4930507C10Rik
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4110 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location183418215-183436808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 183424012 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 78 (R78G)
Ref Sequence ENSEMBL: ENSMUSP00000142121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065900] [ENSMUST00000192527]
Predicted Effect probably benign
Transcript: ENSMUST00000065900
AA Change: R298G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070719
Gene: ENSMUSG00000053461
AA Change: R298G

DomainStartEndE-ValueType
Pfam:Folate_rec 43 205 5.9e-15 PFAM
Pfam:GSDH 215 550 4e-41 PFAM
low complexity region 608 621 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192527
AA Change: R78G

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142121
Gene: ENSMUSG00000053461
AA Change: R78G

DomainStartEndE-ValueType
Pfam:GSDH 1 364 3.2e-37 PFAM
low complexity region 388 401 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193862
Meta Mutation Damage Score 0.1136 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Hhipl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1184:Hhipl2 UTSW 1 183425134 missense probably damaging 1.00
R1607:Hhipl2 UTSW 1 183423524 missense possibly damaging 0.90
R1638:Hhipl2 UTSW 1 183428013 missense probably benign 0.03
R1826:Hhipl2 UTSW 1 183436344 missense probably benign 0.18
R4903:Hhipl2 UTSW 1 183426790 nonsense probably null
R5065:Hhipl2 UTSW 1 183426672 missense probably benign 0.02
R5326:Hhipl2 UTSW 1 183433146 missense probably damaging 1.00
R5542:Hhipl2 UTSW 1 183433146 missense probably damaging 1.00
R5838:Hhipl2 UTSW 1 183423571 missense probably damaging 0.98
R5900:Hhipl2 UTSW 1 183426689 missense possibly damaging 0.94
R6052:Hhipl2 UTSW 1 183424057 missense possibly damaging 0.58
R6225:Hhipl2 UTSW 1 183428551 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGAGGAACCCTGTGTCCATG -3'
(R):5'- TCGAAAACCAGTGCCATCCTTC -3'

Sequencing Primer
(F):5'- TGTGTCCATGGTCCACGCTG -3'
(R):5'- TTCGCTACCATCCTAAGAATGGAGG -3'
Posted On2015-05-15