Incidental Mutation 'R4110:Tbr1'
ID317232
Institutional Source Beutler Lab
Gene Symbol Tbr1
Ensembl Gene ENSMUSG00000035033
Gene NameT-box brain gene 1
Synonyms
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4110 (G1)
Quality Score202
Status Validated
Chromosome2
Chromosomal Location61802930-61814114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61811732 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 184 (P184L)
Ref Sequence ENSEMBL: ENSMUSP00000099798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048934] [ENSMUST00000102737]
Predicted Effect probably benign
Transcript: ENSMUST00000048934
AA Change: P447L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000046787
Gene: ENSMUSG00000035033
AA Change: P447L

DomainStartEndE-ValueType
low complexity region 108 122 N/A INTRINSIC
TBOX 203 398 1.6e-125 SMART
Pfam:T-box_assoc 418 679 9.6e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102737
AA Change: P184L

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099798
Gene: ENSMUSG00000035033
AA Change: P184L

DomainStartEndE-ValueType
TBOX 1 135 5.05e-41 SMART
low complexity region 184 193 N/A INTRINSIC
low complexity region 306 315 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131538
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of numerous developmental processes. In mouse, the ortholog of this gene is expressed in the cerebral cortex, hippocampus, amygdala and olfactory bulb and is thought to play an important role in neuronal migration and axonal projection. In mouse, the C-terminal region of this protein was found to be necessary and sufficient for association with the guanylate kinase domain of calcium/calmodulin-dependent serine protein kinase. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted null allele fail to feed and die on the second postnatal day displaying disrupted forebrain morphology and a hypoplastic olfactory bulb that lacks normal mitral and tufted cells and shows a striking reduction in mature olfactory bulb projection neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Tbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Tbr1 APN 2 61805281 missense probably benign 0.14
IGL01309:Tbr1 APN 2 61806067 missense possibly damaging 0.92
IGL02161:Tbr1 APN 2 61805239 nonsense probably null
IGL02256:Tbr1 APN 2 61804874 missense probably damaging 0.99
IGL02336:Tbr1 APN 2 61804992 missense possibly damaging 0.93
IGL02526:Tbr1 APN 2 61811698 missense probably benign 0.00
FR4340:Tbr1 UTSW 2 61806347 intron probably benign
R0594:Tbr1 UTSW 2 61811620 missense possibly damaging 0.49
R0847:Tbr1 UTSW 2 61805029 missense probably benign 0.00
R1101:Tbr1 UTSW 2 61804739 missense probably benign 0.00
R1247:Tbr1 UTSW 2 61811618 missense possibly damaging 0.78
R1944:Tbr1 UTSW 2 61812256 missense probably damaging 1.00
R3080:Tbr1 UTSW 2 61807291 nonsense probably null
R4111:Tbr1 UTSW 2 61811732 missense probably benign 0.18
R4440:Tbr1 UTSW 2 61804838 missense possibly damaging 0.92
R4790:Tbr1 UTSW 2 61811588 missense probably benign 0.04
R4979:Tbr1 UTSW 2 61805249 unclassified probably null
R5054:Tbr1 UTSW 2 61806002 missense possibly damaging 0.83
R5283:Tbr1 UTSW 2 61804900 missense probably benign 0.00
R5545:Tbr1 UTSW 2 61807376 missense possibly damaging 0.93
R6178:Tbr1 UTSW 2 61804815 missense possibly damaging 0.91
R6290:Tbr1 UTSW 2 61805050 missense probably benign
R6389:Tbr1 UTSW 2 61806287 start gained probably benign
R6637:Tbr1 UTSW 2 61811630 missense probably benign 0.17
R6983:Tbr1 UTSW 2 61811735 missense probably damaging 1.00
R7021:Tbr1 UTSW 2 61807344 missense probably benign 0.18
R7112:Tbr1 UTSW 2 61811816 missense probably benign 0.02
R7254:Tbr1 UTSW 2 61806042 missense probably damaging 1.00
R7291:Tbr1 UTSW 2 61812256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGAGGTGGCTTTCCCTC -3'
(R):5'- TTGGCCTGCTCGTAAATCCC -3'

Sequencing Primer
(F):5'- CCAAAGGGACCTCCGCG -3'
(R):5'- ATACGACAGCAGCGTGGC -3'
Posted On2015-05-15