Incidental Mutation 'R4110:Olfr1239'
ID317233
Institutional Source Beutler Lab
Gene Symbol Olfr1239
Ensembl Gene ENSMUSG00000075088
Gene Nameolfactory receptor 1239
SynonymsGA_x6K02T2Q125-50861284-50860367, MOR231-3
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4110 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89417030-89420407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89418100 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 104 (L104F)
Ref Sequence ENSEMBL: ENSMUSP00000149898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099780] [ENSMUST00000216762] [ENSMUST00000217181]
Predicted Effect probably benign
Transcript: ENSMUST00000099780
AA Change: L104F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097368
Gene: ENSMUSG00000075088
AA Change: L104F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.5e-46 PFAM
Pfam:7tm_1 39 285 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216762
AA Change: L104F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000217181
AA Change: L104F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Olfr1239
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03186:Olfr1239 APN 2 89417844 missense probably damaging 0.99
PIT4810001:Olfr1239 UTSW 2 89417953 missense probably damaging 1.00
R0271:Olfr1239 UTSW 2 89418158 missense probably benign 0.00
R0521:Olfr1239 UTSW 2 89418200 missense probably damaging 1.00
R0667:Olfr1239 UTSW 2 89417688 missense probably benign 0.05
R1738:Olfr1239 UTSW 2 89418018 missense probably benign 0.02
R1955:Olfr1239 UTSW 2 89418411 start codon destroyed probably damaging 1.00
R3114:Olfr1239 UTSW 2 89418413 unclassified probably null
R4111:Olfr1239 UTSW 2 89418100 missense probably benign 0.01
R4796:Olfr1239 UTSW 2 89417891 missense probably damaging 0.99
R4951:Olfr1239 UTSW 2 89417772 missense probably benign 0.01
R5751:Olfr1239 UTSW 2 89417687 missense probably damaging 1.00
R6331:Olfr1239 UTSW 2 89418351 missense probably benign 0.04
R7249:Olfr1239 UTSW 2 89417873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGCAGGCCAATTTTAATAAGG -3'
(R):5'- TCAGCCCAAGTTTAGATGCC -3'

Sequencing Primer
(F):5'- GCAGGCCAATTTTAATAAGGGATAC -3'
(R):5'- AAGTTTAGATGCCCCCATGTAC -3'
Posted On2015-05-15