Incidental Mutation 'R4110:Blvra'
ID317234
Institutional Source Beutler Lab
Gene Symbol Blvra
Ensembl Gene ENSMUSG00000001999
Gene Namebiliverdin reductase A
Synonyms0610006A11Rik, Blvr, 2500001N03Rik
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4110 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127070665-127097084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127095155 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 176 (V176A)
Ref Sequence ENSEMBL: ENSMUSP00000002064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002064] [ENSMUST00000135529] [ENSMUST00000142737]
Predicted Effect probably damaging
Transcript: ENSMUST00000002064
AA Change: V176A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000002064
Gene: ENSMUSG00000001999
AA Change: V176A

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 124 2.1e-22 PFAM
Pfam:Biliv-reduc_cat 132 244 2.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135529
SMART Domains Protein: ENSMUSP00000118278
Gene: ENSMUSG00000001999

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 123 1e-22 PFAM
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142737
SMART Domains Protein: ENSMUSP00000116825
Gene: ENSMUSG00000001999

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 124 4.7e-24 PFAM
Pfam:NAD_binding_3 15 122 1.8e-8 PFAM
Meta Mutation Damage Score 0.34 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: This locus controls electrophoretic mobility of biliverdin reductase. The a allele determines a slowly migrating band in C3H/He, C57BL/H and 101/H; the b allele determines a fast band in BALB/c, CBA/Ca, TFH/H and SM/J. Heterozygotes have both parental bands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Blvra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03149:Blvra APN 2 127082951 missense probably damaging 1.00
R1084:Blvra UTSW 2 127080653 missense probably benign 0.00
R1932:Blvra UTSW 2 127095148 missense probably damaging 1.00
R2114:Blvra UTSW 2 127086069 nonsense probably null
R2115:Blvra UTSW 2 127086069 nonsense probably null
R2117:Blvra UTSW 2 127086069 nonsense probably null
R2122:Blvra UTSW 2 127086897 missense probably damaging 0.96
R3734:Blvra UTSW 2 127090255 intron probably benign
R3847:Blvra UTSW 2 127095191 missense probably damaging 0.96
R4533:Blvra UTSW 2 127090384 unclassified probably null
R4620:Blvra UTSW 2 127096965 missense probably damaging 1.00
R4702:Blvra UTSW 2 127092062 missense probably benign 0.01
R5921:Blvra UTSW 2 127087363 intron probably benign
R6322:Blvra UTSW 2 127080539 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TATTGATCACTGTACACGCATGCG -3'
(R):5'- AATGGTCTTTCGGGTCCTCG -3'

Sequencing Primer
(F):5'- AGGCGAGATGTCCTTTTCTCAGATC -3'
(R):5'- GGTCCTCGTCAGAGTTACCTG -3'
Posted On2015-05-15