Incidental Mutation 'R4110:Hrh3'
ID317239
Institutional Source Beutler Lab
Gene Symbol Hrh3
Ensembl Gene ENSMUSG00000039059
Gene Namehistamine receptor H3
Synonyms
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R4110 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180099465-180104488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 180102850 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 99 (R99L)
Ref Sequence ENSEMBL: ENSMUSP00000127053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056480] [ENSMUST00000163215] [ENSMUST00000164442] [ENSMUST00000165248] [ENSMUST00000165762] [ENSMUST00000166724] [ENSMUST00000171736]
Predicted Effect probably benign
Transcript: ENSMUST00000056480
AA Change: R99L

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049963
Gene: ENSMUSG00000039059
AA Change: R99L

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 7.2e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163215
AA Change: R99L

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127053
Gene: ENSMUSG00000039059
AA Change: R99L

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 376 2e-55 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164442
AA Change: R99L

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130553
Gene: ENSMUSG00000039059
AA Change: R99L

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 380 4.8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165248
AA Change: R99L

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130181
Gene: ENSMUSG00000039059
AA Change: R99L

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 364 6.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165762
AA Change: R99L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132203
Gene: ENSMUSG00000039059
AA Change: R99L

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 1.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166392
Predicted Effect probably benign
Transcript: ENSMUST00000166724
SMART Domains Protein: ENSMUSP00000126336
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 93 1.8e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171736
AA Change: R99L

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127085
Gene: ENSMUSG00000039059
AA Change: R99L

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 239 5.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172211
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. This gene encodes one of the histamine receptors (H3) which belongs to the family 1 of G protein-coupled receptors. It is an integral membrane protein and can regulate neurotransmitter release. This receptor can also increase voltage-dependent calcium current in smooth muscles and innervates the blood vessels and the heart in cardiovascular system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced locomotor activity and body temperature, and attenuated behavioral responses to the drugs thioperamide, methamphetamine, and scopolamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Hrh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Hrh3 APN 2 180101103 missense possibly damaging 0.69
IGL01827:Hrh3 APN 2 180103946 missense possibly damaging 0.95
IGL01912:Hrh3 APN 2 180101376 missense probably damaging 1.00
IGL02992:Hrh3 APN 2 180100815 missense probably benign 0.11
IGL03273:Hrh3 APN 2 180100648 missense possibly damaging 0.85
R1403:Hrh3 UTSW 2 180102754 missense probably damaging 1.00
R1403:Hrh3 UTSW 2 180102754 missense probably damaging 1.00
R1808:Hrh3 UTSW 2 180099784 unclassified probably benign
R2060:Hrh3 UTSW 2 180101250 missense possibly damaging 0.95
R4111:Hrh3 UTSW 2 180102850 missense possibly damaging 0.84
R4113:Hrh3 UTSW 2 180102850 missense possibly damaging 0.84
R4330:Hrh3 UTSW 2 180099872 unclassified probably benign
R4935:Hrh3 UTSW 2 180101268 missense probably damaging 1.00
R5050:Hrh3 UTSW 2 180100557 missense probably damaging 1.00
R5543:Hrh3 UTSW 2 180103970 missense probably damaging 0.99
R5780:Hrh3 UTSW 2 180100815 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCTATAACTCAGGAGCAGC -3'
(R):5'- TGGCAGCTGCTCAGTTGTAG -3'

Sequencing Primer
(F):5'- AGCCATACCCTGTCCAGTG -3'
(R):5'- CTGCTCAGTTGTAGGGGGACAG -3'
Posted On2015-05-15