Incidental Mutation 'R4110:Ptpru'
ID317245
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Nameprotein tyrosine phosphatase, receptor type, U
SynonymsPtprl, RPTPlambda
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4110 (G1)
Quality Score114
Status Validated
Chromosome4
Chromosomal Location131768457-131838288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131819037 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 301 (Y301H)
Ref Sequence ENSEMBL: ENSMUSP00000101607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]
Predicted Effect probably damaging
Transcript: ENSMUST00000030741
AA Change: Y301H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: Y301H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097860
AA Change: Y229H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: Y229H

DomainStartEndE-ValueType
Pfam:MAM 1 116 4.1e-30 PFAM
IG 123 211 4.93e-3 SMART
FN3 213 296 3.79e-2 SMART
FN3 312 400 2.5e-2 SMART
FN3 416 504 3.62e-8 SMART
low complexity region 555 569 N/A INTRINSIC
low complexity region 595 605 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
Blast:PTPc 736 878 3e-49 BLAST
SCOP:d1jlna_ 790 886 9e-19 SMART
PDB:2C7S|A 797 878 7e-22 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000105987
AA Change: Y301H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: Y301H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127633
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131808235 missense probably benign 0.00
IGL00966:Ptpru APN 4 131772616 missense probably damaging 1.00
IGL01451:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01453:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01606:Ptpru APN 4 131808481 missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131776775 splice site probably benign
IGL03135:Ptpru APN 4 131818800 missense probably damaging 0.97
IGL03366:Ptpru APN 4 131779867 missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131799712 missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131802544 nonsense probably null
R0299:Ptpru UTSW 4 131803387 nonsense probably null
R0458:Ptpru UTSW 4 131799675 missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0503:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0619:Ptpru UTSW 4 131820887 missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131771179 missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131797948 missense probably benign 0.10
R1065:Ptpru UTSW 4 131808340 missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131808527 splice site probably benign
R1382:Ptpru UTSW 4 131808229 missense probably damaging 0.98
R1442:Ptpru UTSW 4 131808269 missense probably benign 0.00
R1538:Ptpru UTSW 4 131774351 missense probably damaging 0.99
R1624:Ptpru UTSW 4 131772550 missense probably damaging 1.00
R1688:Ptpru UTSW 4 131787345 missense probably benign 0.01
R1699:Ptpru UTSW 4 131779050 missense probably damaging 1.00
R1740:Ptpru UTSW 4 131793678 splice site probably null
R1874:Ptpru UTSW 4 131769755 missense probably benign
R1959:Ptpru UTSW 4 131803477 missense probably damaging 1.00
R2051:Ptpru UTSW 4 131819087 missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131820813 missense probably damaging 1.00
R2281:Ptpru UTSW 4 131808499 missense probably damaging 1.00
R2304:Ptpru UTSW 4 131772568 missense probably damaging 1.00
R2411:Ptpru UTSW 4 131771469 missense probably damaging 1.00
R2845:Ptpru UTSW 4 131819661 missense probably benign 0.00
R3767:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3768:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3769:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3770:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3937:Ptpru UTSW 4 131774304 missense probably damaging 0.99
R4079:Ptpru UTSW 4 131798710 critical splice donor site probably null
R4170:Ptpru UTSW 4 131776348 missense probably damaging 1.00
R4716:Ptpru UTSW 4 131820968 missense probably benign
R4751:Ptpru UTSW 4 131802586 missense probably damaging 0.97
R4766:Ptpru UTSW 4 131820964 missense probably damaging 1.00
R4825:Ptpru UTSW 4 131799603 missense probably benign
R4900:Ptpru UTSW 4 131788382 missense probably damaging 0.99
R4998:Ptpru UTSW 4 131776885 missense probably damaging 1.00
R5279:Ptpru UTSW 4 131820023 missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131772557 missense probably damaging 1.00
R5625:Ptpru UTSW 4 131803380 missense probably null 1.00
R5667:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131838090 missense probably benign 0.01
R5802:Ptpru UTSW 4 131788377 missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131785756 missense probably benign 0.34
R5953:Ptpru UTSW 4 131776837 missense probably damaging 1.00
R5973:Ptpru UTSW 4 131818925 missense probably benign 0.00
R6029:Ptpru UTSW 4 131771293 missense probably damaging 1.00
R6072:Ptpru UTSW 4 131776228 missense probably damaging 0.99
R6089:Ptpru UTSW 4 131772630 missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131785754 missense probably benign
R6177:Ptpru UTSW 4 131793525 missense probably benign 0.00
R6367:Ptpru UTSW 4 131774352 missense probably benign 0.18
R6682:Ptpru UTSW 4 131820782 missense probably benign
R6950:Ptpru UTSW 4 131776352 missense probably damaging 0.99
R7159:Ptpru UTSW 4 131819540 missense probably damaging 1.00
X0024:Ptpru UTSW 4 131771190 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGCACGCTGATTTCATACTCAGTG -3'
(R):5'- AACAGTGTTGCCAGGCAGAG -3'

Sequencing Primer
(F):5'- CGCTGATTTCATACTCAGTGTCTGG -3'
(R):5'- AGCCCGGGCCTAAATTCCTATG -3'
Posted On2015-05-15