Incidental Mutation 'R4110:Dscaml1'
ID317257
Institutional Source Beutler Lab
Gene Symbol Dscaml1
Ensembl Gene ENSMUSG00000032087
Gene NameDS cell adhesion molecule like 1
Synonyms4921507G06Rik, 4930435C18Rik
MMRRC Submission 040988-MU
Accession Numbers

Genbank: NM_001081270; MGI: 2150309

Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R4110 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location45426628-45753712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45732068 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1262 (A1262T)
Ref Sequence ENSEMBL: ENSMUSP00000034592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034592]
Predicted Effect probably benign
Transcript: ENSMUST00000034592
AA Change: A1262T

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087
AA Change: A1262T

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 28 55 N/A INTRINSIC
IG_like 96 168 1.22e0 SMART
IG 189 277 1.15e-3 SMART
IGc2 296 359 2.54e-14 SMART
IGc2 385 451 8.12e-13 SMART
IGc2 478 550 9.55e-10 SMART
IGc2 575 640 9.78e-7 SMART
IGc2 666 734 5.93e-6 SMART
IGc2 760 832 6.75e-10 SMART
IG 853 943 1e-3 SMART
FN3 945 1029 6.64e-7 SMART
FN3 1045 1133 9.46e-12 SMART
FN3 1148 1234 3.2e-9 SMART
FN3 1249 1332 3.48e-10 SMART
IGc2 1363 1428 1.49e-11 SMART
FN3 1442 1522 3.42e-9 SMART
FN3 1537 1618 2.14e-1 SMART
low complexity region 1671 1683 N/A INTRINSIC
low complexity region 2018 2026 N/A INTRINSIC
low complexity region 2035 2069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216685
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Dscaml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dscaml1 APN 9 45670200 nonsense probably null
IGL00497:Dscaml1 APN 9 45752238 missense probably damaging 1.00
IGL00895:Dscaml1 APN 9 45751253 missense probably damaging 0.99
IGL01011:Dscaml1 APN 9 45683672 missense possibly damaging 0.76
IGL01086:Dscaml1 APN 9 45702662 splice site probably benign
IGL01125:Dscaml1 APN 9 45749632 critical splice acceptor site probably null
IGL01132:Dscaml1 APN 9 45752328 nonsense probably null
IGL01356:Dscaml1 APN 9 45746857 missense probably benign 0.03
IGL01459:Dscaml1 APN 9 45742683 nonsense probably null
IGL01552:Dscaml1 APN 9 45447908 missense probably damaging 1.00
IGL02033:Dscaml1 APN 9 45683782 missense probably damaging 1.00
IGL02044:Dscaml1 APN 9 45746943 nonsense probably null
IGL02095:Dscaml1 APN 9 45447703 missense probably damaging 1.00
IGL02166:Dscaml1 APN 9 45683701 missense probably damaging 0.98
IGL02262:Dscaml1 APN 9 45745116 missense probably benign
IGL02262:Dscaml1 APN 9 45732080 missense probably benign 0.44
IGL02340:Dscaml1 APN 9 45670176 missense possibly damaging 0.66
IGL02604:Dscaml1 APN 9 45744328 unclassified probably benign
IGL02619:Dscaml1 APN 9 45447796 missense probably damaging 1.00
IGL02805:Dscaml1 APN 9 45447897 missense probably damaging 0.98
IGL03409:Dscaml1 APN 9 45670103 missense probably damaging 1.00
D3080:Dscaml1 UTSW 9 45684325 missense probably benign 0.44
IGL03050:Dscaml1 UTSW 9 45742999 missense probably damaging 1.00
R0149:Dscaml1 UTSW 9 45742680 nonsense probably null
R0582:Dscaml1 UTSW 9 45668264 missense possibly damaging 0.77
R0629:Dscaml1 UTSW 9 45721418 missense probably damaging 0.98
R0632:Dscaml1 UTSW 9 45732134 missense probably benign 0.06
R0815:Dscaml1 UTSW 9 45745074 missense probably benign 0.00
R1162:Dscaml1 UTSW 9 45752349 splice site probably benign
R1449:Dscaml1 UTSW 9 45742223 missense possibly damaging 0.95
R1474:Dscaml1 UTSW 9 45685221 missense probably damaging 1.00
R1481:Dscaml1 UTSW 9 45672643 missense probably benign 0.01
R1533:Dscaml1 UTSW 9 45450584 missense probably damaging 0.99
R1542:Dscaml1 UTSW 9 45749440 missense possibly damaging 0.84
R1572:Dscaml1 UTSW 9 45721333 missense probably benign 0.00
R1627:Dscaml1 UTSW 9 45753147 missense probably damaging 1.00
R1634:Dscaml1 UTSW 9 45672749 missense probably damaging 1.00
R1713:Dscaml1 UTSW 9 45752690 missense possibly damaging 0.49
R1777:Dscaml1 UTSW 9 45683756 missense possibly damaging 0.58
R1812:Dscaml1 UTSW 9 45751286 critical splice donor site probably null
R1834:Dscaml1 UTSW 9 45683632 missense probably benign 0.00
R1907:Dscaml1 UTSW 9 45740480 missense probably damaging 1.00
R1953:Dscaml1 UTSW 9 45670224 missense probably benign 0.01
R2056:Dscaml1 UTSW 9 45750132 missense probably damaging 0.99
R2193:Dscaml1 UTSW 9 45685234 missense probably benign 0.21
R2497:Dscaml1 UTSW 9 45745078 missense probably benign 0.00
R3768:Dscaml1 UTSW 9 45732137 missense possibly damaging 0.94
R3891:Dscaml1 UTSW 9 45717484 missense possibly damaging 0.84
R4706:Dscaml1 UTSW 9 45450580 missense probably damaging 1.00
R4716:Dscaml1 UTSW 9 45450592 missense probably damaging 1.00
R4719:Dscaml1 UTSW 9 45672695 missense probably benign 0.13
R4770:Dscaml1 UTSW 9 45670106 missense probably damaging 1.00
R4924:Dscaml1 UTSW 9 45745189 missense probably damaging 1.00
R5167:Dscaml1 UTSW 9 45717432 missense probably damaging 1.00
R5346:Dscaml1 UTSW 9 45450559 missense possibly damaging 0.63
R5737:Dscaml1 UTSW 9 45745185 missense probably damaging 0.99
R5977:Dscaml1 UTSW 9 45721298 missense probably benign 0.19
R6073:Dscaml1 UTSW 9 45450583 missense probably benign 0.22
R6276:Dscaml1 UTSW 9 45668160 missense possibly damaging 0.62
R6415:Dscaml1 UTSW 9 45683677 nonsense probably null
R6527:Dscaml1 UTSW 9 45712184 nonsense probably null
R6582:Dscaml1 UTSW 9 45752806 missense probably benign 0.00
R6655:Dscaml1 UTSW 9 45746937 missense probably benign 0.00
R6772:Dscaml1 UTSW 9 45710311 missense probably damaging 1.00
R6799:Dscaml1 UTSW 9 45450583 missense probably benign 0.22
R6892:Dscaml1 UTSW 9 45683830 missense probably damaging 0.99
R6918:Dscaml1 UTSW 9 45430507 missense probably benign
R6967:Dscaml1 UTSW 9 45674523 missense probably damaging 0.97
R7214:Dscaml1 UTSW 9 45670139 missense probably benign 0.01
R7286:Dscaml1 UTSW 9 45742746 critical splice donor site probably null
R7315:Dscaml1 UTSW 9 45745125 missense probably benign 0.00
X0058:Dscaml1 UTSW 9 45752128 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCACCTCAGAGCATGTCAC -3'
(R):5'- TCACAGAAAAGTATAGGTAAGTCCC -3'

Sequencing Primer
(F):5'- GAGCATGTCACACCCCCTTG -3'
(R):5'- AGGTAAGTCCCACAGTTTGACTGAC -3'
Posted On2015-05-15