Incidental Mutation 'R4110:Man2c1'
ID317258
Institutional Source Beutler Lab
Gene Symbol Man2c1
Ensembl Gene ENSMUSG00000032295
Gene Namemannosidase, alpha, class 2C, member 1
Synonyms
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4110 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57130690-57142722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57136771 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 330 (N330S)
Ref Sequence ENSEMBL: ENSMUSP00000124124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034836] [ENSMUST00000159130] [ENSMUST00000160147] [ENSMUST00000160584] [ENSMUST00000161182] [ENSMUST00000161338] [ENSMUST00000161393] [ENSMUST00000161663] [ENSMUST00000162915]
Predicted Effect probably damaging
Transcript: ENSMUST00000034836
AA Change: N289S

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034836
Gene: ENSMUSG00000032295
AA Change: N289S

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 4.3e-89 PFAM
Alpha-mann_mid 516 593 1.37e-26 SMART
low complexity region 603 613 N/A INTRINSIC
Pfam:Glyco_hydro_38C 619 1029 1.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159101
SMART Domains Protein: ENSMUSP00000124304
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Alpha-mann_mid 21 100 1.22e-32 SMART
low complexity region 110 120 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160042
Predicted Effect probably benign
Transcript: ENSMUST00000160147
AA Change: N289S

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125478
Gene: ENSMUSG00000032295
AA Change: N289S

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 2.8e-86 PFAM
Alpha-mann_mid 516 595 1.22e-32 SMART
low complexity region 605 615 N/A INTRINSIC
Pfam:Glyco_hydro_38C 621 1031 1.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160280
Predicted Effect probably benign
Transcript: ENSMUST00000160426
SMART Domains Protein: ENSMUSP00000124005
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Alpha-mann_mid 24 77 4.48e-1 SMART
low complexity region 87 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160584
SMART Domains Protein: ENSMUSP00000123840
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161182
SMART Domains Protein: ENSMUSP00000124020
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38 175 411 9.4e-67 PFAM
Alpha-mann_mid 417 496 1.22e-32 SMART
low complexity region 506 516 N/A INTRINSIC
Pfam:Glyco_hydro_38C 522 932 1.1e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161338
Predicted Effect probably benign
Transcript: ENSMUST00000161393
Predicted Effect probably damaging
Transcript: ENSMUST00000161663
AA Change: N330S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124124
Gene: ENSMUSG00000032295
AA Change: N330S

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 302 551 1.8e-81 PFAM
Alpha-mann_mid 557 636 1.22e-32 SMART
low complexity region 646 656 N/A INTRINSIC
Pfam:Glyco_hydro_38C 662 866 1.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162634
Predicted Effect probably benign
Transcript: ENSMUST00000162915
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Germ line null mutants display neuronal and glia degeneration, glycogen accumulation, and liver and kidney damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Man2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Man2c1 APN 9 57141819 missense probably benign
IGL01408:Man2c1 APN 9 57141600 missense probably damaging 1.00
IGL01618:Man2c1 APN 9 57141556 unclassified probably benign
IGL01750:Man2c1 APN 9 57140780 critical splice donor site probably null
IGL01796:Man2c1 APN 9 57137960 missense possibly damaging 0.52
IGL02661:Man2c1 APN 9 57137482 missense probably damaging 1.00
IGL03166:Man2c1 APN 9 57139098 missense probably damaging 1.00
IGL03176:Man2c1 APN 9 57140746 missense probably benign 0.05
IGL03209:Man2c1 APN 9 57141830 missense probably benign 0.00
R0014:Man2c1 UTSW 9 57139701 missense probably benign 0.00
R0329:Man2c1 UTSW 9 57141183 missense probably benign 0.40
R0432:Man2c1 UTSW 9 57135597 missense probably damaging 1.00
R1448:Man2c1 UTSW 9 57135219 missense probably benign 0.23
R1616:Man2c1 UTSW 9 57135509 missense probably benign 0.00
R1838:Man2c1 UTSW 9 57137337 missense probably benign 0.07
R2511:Man2c1 UTSW 9 57141388 splice site probably null
R3751:Man2c1 UTSW 9 57140774 missense probably damaging 1.00
R3771:Man2c1 UTSW 9 57140377 unclassified probably benign
R3772:Man2c1 UTSW 9 57140377 unclassified probably benign
R4116:Man2c1 UTSW 9 57140305 critical splice donor site probably null
R4167:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4169:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4170:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4405:Man2c1 UTSW 9 57139083 missense probably damaging 0.98
R4551:Man2c1 UTSW 9 57131161 missense probably damaging 1.00
R4618:Man2c1 UTSW 9 57142155 unclassified probably null
R4798:Man2c1 UTSW 9 57141185 nonsense probably null
R4903:Man2c1 UTSW 9 57138956 missense probably benign 0.08
R5030:Man2c1 UTSW 9 57140639 missense probably benign 0.00
R5079:Man2c1 UTSW 9 57136716 missense probably damaging 1.00
R5086:Man2c1 UTSW 9 57131640 missense probably damaging 0.96
R6430:Man2c1 UTSW 9 57131233 missense possibly damaging 0.91
R6695:Man2c1 UTSW 9 57141591 missense probably benign 0.03
R6743:Man2c1 UTSW 9 57135565 missense probably benign 0.41
R7011:Man2c1 UTSW 9 57137833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAGGTCTGCAGGGTAGAC -3'
(R):5'- CCCATTCAAGTTGTTGTGCCTG -3'

Sequencing Primer
(F):5'- TGACCCACTGGAGCCTTAG -3'
(R):5'- GCCTGTGGGGAACATGG -3'
Posted On2015-05-15