Incidental Mutation 'R0391:Col14a1'
ID31726
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Namecollagen, type XIV, alpha 1
Synonyms5730412L22Rik
MMRRC Submission 038597-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0391 (G1)
Quality Score219
Status Validated
Chromosome15
Chromosomal Location55307750-55520803 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 55446259 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
Predicted Effect unknown
Transcript: ENSMUST00000023053
AA Change: D1149G
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: D1149G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110217
AA Change: D1150G
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: D1150G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110221
AA Change: D1146G
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: D1146G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125416
SMART Domains Protein: ENSMUSP00000122455
Gene: ENSMUSG00000022371

DomainStartEndE-ValueType
TSPN 2 165 2.04e-42 SMART
Pfam:Collagen 201 255 2.1e-9 PFAM
Pfam:Collagen 253 305 3.3e-9 PFAM
Pfam:Collagen 295 355 4.4e-11 PFAM
Pfam:Collagen 393 448 5.7e-11 PFAM
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,701,177 probably benign Het
Abcc2 G A 19: 43,821,605 probably benign Het
Abcc8 C G 7: 46,122,173 G838A probably damaging Het
Akr1c21 G A 13: 4,581,200 A245T probably damaging Het
Anapc15-ps T C 10: 95,673,277 E47G probably damaging Het
Apoa1 A G 9: 46,229,842 T79A probably benign Het
Atp6v1b1 A G 6: 83,756,921 H378R possibly damaging Het
C4b A G 17: 34,735,614 probably benign Het
Catsperd A T 17: 56,662,821 E638D probably benign Het
Cckar C T 5: 53,706,253 probably null Het
Cfap100 C T 6: 90,405,339 probably benign Het
Chd1 G T 17: 15,749,894 G970C probably damaging Het
Col17a1 C T 19: 47,663,824 V698M probably damaging Het
Cpeb1 T C 7: 81,361,725 D156G possibly damaging Het
Cryl1 A G 14: 57,303,775 Y151H possibly damaging Het
Csmd3 C A 15: 47,657,573 V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 A73T probably damaging Het
Cyp2c37 T C 19: 39,994,506 S180P probably damaging Het
Cyp2c54 T C 19: 40,072,169 T123A possibly damaging Het
Dennd6b T C 15: 89,187,214 D304G probably damaging Het
Dnmt3l T C 10: 78,051,916 probably benign Het
Eci1 G A 17: 24,433,260 probably null Het
Efhc1 A G 1: 20,960,188 Y115C probably damaging Het
Ern1 T A 11: 106,407,178 K706* probably null Het
Fam129c T A 8: 71,602,499 probably benign Het
Ghrl T C 6: 113,719,338 E31G probably damaging Het
Gpr108 A C 17: 57,243,101 V179G probably benign Het
Henmt1 A G 3: 108,958,535 probably benign Het
Ift172 A G 5: 31,286,667 V69A probably damaging Het
Il17ra T C 6: 120,476,979 probably benign Het
Il17rb T C 14: 30,004,347 N95D probably benign Het
Il17rb G T 14: 30,006,155 probably null Het
Iqub G A 6: 24,446,155 L757F probably benign Het
Itpr1 T C 6: 108,378,167 V473A probably benign Het
Itpr2 T G 6: 146,229,773 N1978H probably damaging Het
Klk1b26 T A 7: 44,012,727 F3Y probably damaging Het
Lars A G 18: 42,251,363 V50A probably benign Het
Lax1 G T 1: 133,680,066 H312Q probably benign Het
Lctl T C 9: 64,122,314 probably benign Het
Lrp2 T A 2: 69,456,858 D3745V probably damaging Het
Lrp2 G A 2: 69,460,337 probably benign Het
Lvrn A T 18: 46,850,466 H92L probably benign Het
March1 A G 8: 66,418,973 T385A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mbd5 T C 2: 49,272,416 V970A possibly damaging Het
Mccc1 A G 3: 35,963,570 probably benign Het
Mpp4 A T 1: 59,143,829 probably benign Het
Mrnip G A 11: 50,199,920 A304T probably damaging Het
Muc5b T C 7: 141,865,082 S3922P possibly damaging Het
Myh3 T A 11: 67,096,507 probably benign Het
Nbea A T 3: 56,037,277 H555Q probably damaging Het
Nlrp9c A T 7: 26,371,476 probably benign Het
Nmur1 A T 1: 86,387,678 V178E probably damaging Het
Nod2 T G 8: 88,663,778 S238A probably benign Het
Ogfod1 A T 8: 94,063,023 T451S probably damaging Het
Olfr145 G A 9: 37,897,842 G146D probably benign Het
Olfr23 T C 11: 73,941,109 F288L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr716 T A 7: 107,148,187 Y290* probably null Het
Pcdh20 T C 14: 88,468,668 I399V probably benign Het
Pdlim1 G T 19: 40,243,573 H120Q probably damaging Het
Plg T C 17: 12,419,081 V798A probably damaging Het
Polr2c A G 8: 94,857,775 I39V possibly damaging Het
Ppfia2 C A 10: 106,830,714 probably benign Het
Ppp1r3a A T 6: 14,719,697 I406N probably benign Het
Psg28 A T 7: 18,426,173 M366K probably benign Het
Rad54b T C 4: 11,601,702 I419T probably damaging Het
Rnf43 A G 11: 87,731,282 Q403R possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc28a3 A G 13: 58,569,415 probably benign Het
Smad2 A T 18: 76,289,037 probably null Het
Smad4 G A 18: 73,658,649 P274S probably benign Het
Smchd1 A T 17: 71,403,154 V906D probably damaging Het
Soat2 C A 15: 102,158,753 R320S possibly damaging Het
Spata33 C T 8: 123,221,887 A57V probably damaging Het
Stab1 A G 14: 31,143,418 L1814P probably benign Het
Stab2 T C 10: 86,947,144 K680R probably benign Het
Stil A G 4: 115,041,172 probably null Het
Sympk T A 7: 19,046,849 L759H probably benign Het
Tet1 A T 10: 62,814,546 probably null Het
Tfpi2 A T 6: 3,965,460 N117K probably benign Het
Tle3 A G 9: 61,416,661 Y766C probably damaging Het
Trpt1 C A 19: 6,997,930 probably null Het
Tshz1 A G 18: 84,016,049 F78S possibly damaging Het
Ttc1 T C 11: 43,738,808 D177G probably damaging Het
Ttc13 T A 8: 124,674,401 Y741F probably damaging Het
Ulk3 C T 9: 57,594,832 S462L probably benign Het
Utrn C T 10: 12,525,333 probably benign Het
V1rd19 A C 7: 24,003,585 T159P probably damaging Het
Vars T C 17: 35,011,486 V515A possibly damaging Het
Vmn1r85 A G 7: 13,084,588 Y210H probably benign Het
Vmn2r89 A G 14: 51,455,978 T262A probably damaging Het
Vps53 G A 11: 76,121,579 T209I probably benign Het
Wdfy2 T C 14: 62,925,133 F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 S694Y probably damaging Het
Zbtb8b T A 4: 129,432,670 D201V probably damaging Het
Zmym5 A C 14: 56,804,451 N123K possibly damaging Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55411585 missense unknown
IGL01290:Col14a1 APN 15 55423507 missense unknown
IGL01300:Col14a1 APN 15 55467976 missense unknown
IGL01505:Col14a1 APN 15 55455223 missense unknown
IGL01533:Col14a1 APN 15 55420840 missense unknown
IGL01563:Col14a1 APN 15 55487941 missense unknown
IGL01650:Col14a1 APN 15 55406693 missense unknown
IGL01659:Col14a1 APN 15 55446172 unclassified probably benign
IGL01670:Col14a1 APN 15 55329266 missense unknown
IGL01760:Col14a1 APN 15 55423459 missense unknown
IGL01803:Col14a1 APN 15 55418814 missense unknown
IGL01966:Col14a1 APN 15 55448725 unclassified probably benign
IGL01990:Col14a1 APN 15 55363463 missense unknown
IGL02124:Col14a1 APN 15 55463703 missense unknown
IGL02138:Col14a1 APN 15 55420835 missense unknown
IGL02192:Col14a1 APN 15 55362402 missense unknown
IGL02326:Col14a1 APN 15 55418797 missense unknown
IGL02335:Col14a1 APN 15 55463769 splice site probably benign
IGL02407:Col14a1 APN 15 55448876 splice site probably benign
IGL02486:Col14a1 APN 15 55388696 splice site probably benign
IGL02537:Col14a1 APN 15 55344914 nonsense probably null
IGL02567:Col14a1 APN 15 55344961 critical splice donor site probably null
IGL02643:Col14a1 APN 15 55420862 missense unknown
IGL02669:Col14a1 APN 15 55418782 missense unknown
IGL02673:Col14a1 APN 15 55418782 missense unknown
IGL02674:Col14a1 APN 15 55418782 missense unknown
IGL03201:Col14a1 APN 15 55408904 missense unknown
IGL03334:Col14a1 APN 15 55448821 unclassified probably benign
IGL03370:Col14a1 APN 15 55488541 splice site probably null
IGL03385:Col14a1 APN 15 55410204 missense unknown
IGL03385:Col14a1 APN 15 55471708 missense unknown
PIT4131001:Col14a1 UTSW 15 55448876 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0173:Col14a1 UTSW 15 55488532 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55407868 splice site probably benign
R0468:Col14a1 UTSW 15 55388646 missense unknown
R0652:Col14a1 UTSW 15 55344882 missense unknown
R0692:Col14a1 UTSW 15 55341738 missense unknown
R0745:Col14a1 UTSW 15 55338417 missense unknown
R1006:Col14a1 UTSW 15 55519935 missense probably benign 0.04
R1331:Col14a1 UTSW 15 55410188 missense unknown
R1537:Col14a1 UTSW 15 55380767 missense unknown
R1557:Col14a1 UTSW 15 55388579 missense unknown
R1721:Col14a1 UTSW 15 55447462 unclassified probably benign
R1737:Col14a1 UTSW 15 55344961 critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55382495 missense unknown
R1867:Col14a1 UTSW 15 55447462 unclassified probably benign
R1868:Col14a1 UTSW 15 55447462 unclassified probably benign
R1991:Col14a1 UTSW 15 55449940 missense unknown
R2020:Col14a1 UTSW 15 55446181 unclassified probably benign
R2103:Col14a1 UTSW 15 55449940 missense unknown
R2116:Col14a1 UTSW 15 55407764 missense unknown
R2163:Col14a1 UTSW 15 55444645 unclassified probably benign
R2207:Col14a1 UTSW 15 55463686 missense unknown
R2215:Col14a1 UTSW 15 55380842 missense unknown
R2264:Col14a1 UTSW 15 55466690 splice site probably null
R2383:Col14a1 UTSW 15 55447517 unclassified probably benign
R2397:Col14a1 UTSW 15 55338439 missense unknown
R2422:Col14a1 UTSW 15 55449922 missense unknown
R3793:Col14a1 UTSW 15 55363513 missense unknown
R4082:Col14a1 UTSW 15 55437033 missense unknown
R4112:Col14a1 UTSW 15 55363559 missense unknown
R4519:Col14a1 UTSW 15 55388579 missense unknown
R4628:Col14a1 UTSW 15 55449833 nonsense probably null
R4692:Col14a1 UTSW 15 55423468 missense unknown
R4696:Col14a1 UTSW 15 55372602 missense unknown
R4749:Col14a1 UTSW 15 55452336 missense unknown
R5324:Col14a1 UTSW 15 55338445 missense unknown
R5382:Col14a1 UTSW 15 55362436 missense unknown
R5634:Col14a1 UTSW 15 55518298 missense probably damaging 1.00
R5781:Col14a1 UTSW 15 55423512 missense unknown
R5828:Col14a1 UTSW 15 55436976 missense unknown
R5873:Col14a1 UTSW 15 55445786 unclassified probably benign
R5966:Col14a1 UTSW 15 55452383 critical splice donor site probably null
R6106:Col14a1 UTSW 15 55520008 missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55380850 missense unknown
R6319:Col14a1 UTSW 15 55516169 missense probably damaging 0.99
R6475:Col14a1 UTSW 15 55445822 unclassified probably benign
R6540:Col14a1 UTSW 15 55372581 missense unknown
R6893:Col14a1 UTSW 15 55444648 unclassified probably benign
X0023:Col14a1 UTSW 15 55423447 missense unknown
X0063:Col14a1 UTSW 15 55410215 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCACTCTTTTCACCTGGAGAAAGC -3'
(R):5'- GCTGCTGTTCCCTAGACAAGAAACC -3'

Sequencing Primer
(F):5'- TCACCTGGAGAAAGCATGTGAAG -3'
(R):5'- GCACCTAATTACAGAATTGTCAAGGC -3'
Posted On2013-04-24