Incidental Mutation 'R4110:Sgca'
ID317262
Institutional Source Beutler Lab
Gene Symbol Sgca
Ensembl Gene ENSMUSG00000001508
Gene Namesarcoglycan, alpha (dystrophin-associated glycoprotein)
Synonyms50DAG, adhalin, Asg
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4110 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94962791-94976327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94972570 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 27 (T27A)
Ref Sequence ENSEMBL: ENSMUSP00000118455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038928] [ENSMUST00000100551] [ENSMUST00000103162] [ENSMUST00000139855] [ENSMUST00000152042] [ENSMUST00000166320]
Predicted Effect probably benign
Transcript: ENSMUST00000038928
SMART Domains Protein: ENSMUSP00000039866
Gene: ENSMUSG00000038994

DomainStartEndE-ValueType
Pfam:Linker_histone 35 106 5.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100551
AA Change: T27A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098118
Gene: ENSMUSG00000001508
AA Change: T27A

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103162
AA Change: T27A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099451
Gene: ENSMUSG00000001508
AA Change: T27A

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139855
SMART Domains Protein: ENSMUSP00000117637
Gene: ENSMUSG00000001508

DomainStartEndE-ValueType
Pfam:Sarcoglycan_2 1 140 2.1e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000152042
AA Change: T27A

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118455
Gene: ENSMUSG00000001508
AA Change: T27A

DomainStartEndE-ValueType
Pfam:Sarcoglycan_2 6 100 5.9e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166320
AA Change: T27A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130617
Gene: ENSMUSG00000001508
AA Change: T27A

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a member of the sarcoglycan alpha/epsilon family of transmembrane proteins. The encoded protein is part of the dystrophin-glycoprotein complex which links the extracellular matrix to the cytoskeleton in muscle fibers. Disruption of this gene results in progressive muscular dystrophy and is associated with the development of embryonal rhabdomysarcoma. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mutation of this gene results in muscle abnormalities, with decreased skeletal muscle force and stiffness and muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Sgca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Sgca APN 11 94972287 missense probably damaging 1.00
IGL01479:Sgca APN 11 94963378 nonsense probably null
IGL02153:Sgca APN 11 94963284 missense probably damaging 1.00
IGL02713:Sgca APN 11 94971305 missense probably damaging 1.00
IGL02928:Sgca APN 11 94972303 missense probably damaging 1.00
IGL03185:Sgca APN 11 94970784 missense probably benign 0.00
R0602:Sgca UTSW 11 94963235 missense possibly damaging 0.94
R0834:Sgca UTSW 11 94970686 nonsense probably null
R1547:Sgca UTSW 11 94969433 missense probably damaging 1.00
R1703:Sgca UTSW 11 94969391 missense probably damaging 0.97
R4112:Sgca UTSW 11 94972570 missense possibly damaging 0.63
R4796:Sgca UTSW 11 94970727 unclassified probably null
R5301:Sgca UTSW 11 94963331 missense probably damaging 1.00
R6301:Sgca UTSW 11 94972567 missense probably damaging 1.00
R6347:Sgca UTSW 11 94972028 missense probably damaging 1.00
R6510:Sgca UTSW 11 94963232 missense probably benign 0.36
R7110:Sgca UTSW 11 94963401 critical splice acceptor site probably null
R7121:Sgca UTSW 11 94969547 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGCCAGGGTTATAGGGACTG -3'
(R):5'- AGAAGTCTGGGTCCTGTCAC -3'

Sequencing Primer
(F):5'- TGTGTAGTGCAGCCACCTG -3'
(R):5'- TACACAGCAGAGTAGGATCTATACC -3'
Posted On2015-05-15