Incidental Mutation 'R4110:Fzd3'
ID317271
Institutional Source Beutler Lab
Gene Symbol Fzd3
Ensembl Gene ENSMUSG00000007989
Gene Namefrizzled class receptor 3
SynonymsD930050A07Rik, Fz3
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4110 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location65192449-65262463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65235167 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 384 (V384A)
Ref Sequence ENSEMBL: ENSMUSP00000115325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131309]
Predicted Effect probably benign
Transcript: ENSMUST00000131309
AA Change: V384A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115325
Gene: ENSMUSG00000007989
AA Change: V384A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FRI 27 138 3.39e-63 SMART
Frizzled 192 517 5.6e-184 SMART
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. The function of this protein is unknown, although it may play a role in mammalian hair follicle development. Alternative splicing results in multiple transcript variants. This gene is a susceptibility locus for schizophrenia. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruption of this gene die within 30 minutes of birth. Breathing is irregular. Brain development is abnormal with occasion falure of the cephalic neural tube to close. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Fzd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Fzd3 APN 14 65239898 missense probably damaging 1.00
IGL02505:Fzd3 APN 14 65253106 missense probably benign
IGL02568:Fzd3 APN 14 65235940 splice site probably benign
R1161:Fzd3 UTSW 14 65212088 missense probably damaging 1.00
R1563:Fzd3 UTSW 14 65235724 missense probably damaging 1.00
R1616:Fzd3 UTSW 14 65235507 missense probably benign
R1636:Fzd3 UTSW 14 65253106 missense probably benign
R1826:Fzd3 UTSW 14 65253106 missense probably benign
R2071:Fzd3 UTSW 14 65235563 missense probably damaging 1.00
R2174:Fzd3 UTSW 14 65212231 splice site probably benign
R3857:Fzd3 UTSW 14 65239839 missense possibly damaging 0.84
R3859:Fzd3 UTSW 14 65239839 missense possibly damaging 0.84
R3917:Fzd3 UTSW 14 65235930 missense probably damaging 0.97
R4396:Fzd3 UTSW 14 65235605 missense probably damaging 0.99
R4740:Fzd3 UTSW 14 65235744 missense possibly damaging 0.89
R4796:Fzd3 UTSW 14 65235158 missense possibly damaging 0.89
R4838:Fzd3 UTSW 14 65239820 missense probably benign 0.00
R5916:Fzd3 UTSW 14 65202729 missense probably benign 0.29
R6240:Fzd3 UTSW 14 65209855 missense probably damaging 1.00
R6732:Fzd3 UTSW 14 65235803 missense probably benign 0.44
R6892:Fzd3 UTSW 14 65209881 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTGATACTCTCTGCAGCGTTC -3'
(R):5'- TGCTGTTTCATGCCAGTGC -3'

Sequencing Primer
(F):5'- CCGCGGTAAGCTTGCTCATAAAAG -3'
(R):5'- CCCCGGAACTCTAACTATCA -3'
Posted On2015-05-15