Incidental Mutation 'R4110:Pdzrn4'
ID317275
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene NamePDZ domain containing RING finger 4
Synonyms1110017D07Rik, LNX4, SAMCAP3L
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R4110 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location92396881-92771819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92770864 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 966 (I966V)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]
Predicted Effect probably benign
Transcript: ENSMUST00000035399
AA Change: I727V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: I727V

DomainStartEndE-ValueType
Blast:PDZ 1 56 4e-24 BLAST
SCOP:d1qaua_ 20 61 1e-3 SMART
PDB:1UHP|A 21 64 9e-12 PDB
PDZ 154 229 3.01e-18 SMART
low complexity region 240 259 N/A INTRINSIC
low complexity region 267 278 N/A INTRINSIC
coiled coil region 394 430 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169942
AA Change: I966V

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: I966V

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92746278 missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92401926 splice site probably null
IGL02103:Pdzrn4 APN 15 92769887 missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92770696 missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92769850 missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92770391 missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92769881 missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92770319 missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92757657 missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92757711 missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92770271 missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92771013 makesense probably null
R1466:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92677712 missense probably benign
R1503:Pdzrn4 UTSW 15 92399804 missense probably damaging 0.99
R1561:Pdzrn4 UTSW 15 92677637 missense possibly damaging 0.84
R1584:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92401974 missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92746309 splice site probably null
R2061:Pdzrn4 UTSW 15 92770160 missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92769811 missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92399749 missense probably benign
R4032:Pdzrn4 UTSW 15 92769533 missense probably damaging 1.00
R4180:Pdzrn4 UTSW 15 92402017 missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92770589 missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92769842 missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92770252 nonsense probably null
R4900:Pdzrn4 UTSW 15 92770757 missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92677621 missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92770925 missense probably damaging 1.00
R5772:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92397374 missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92680537 missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92677574 missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92770422 nonsense probably null
R7096:Pdzrn4 UTSW 15 92397503 missense probably benign 0.00
X0018:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92677709 missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92680512 missense possibly damaging 0.92
X0065:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAACGTGCCTTAAAGATCAAGG -3'
(R):5'- AAGCCAGTTGTCCCCATGTG -3'

Sequencing Primer
(F):5'- TGGCATGACCACAGACGACG -3'
(R):5'- CCCATGTGTCTGGTCATACGG -3'
Posted On2015-05-15