Incidental Mutation 'R4110:Rpl24'
ID317276
Institutional Source Beutler Lab
Gene Symbol Rpl24
Ensembl Gene ENSMUSG00000098274
Gene Nameribosomal protein L24
Synonyms0610008L05Rik, Bst
MMRRC Submission 040988-MU
Accession Numbers

Ncbi RefSeq: NM_024218.4; MGI:1915443

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4110 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location55966275-55971435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55971360 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000023269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023269] [ENSMUST00000050248]
Predicted Effect probably benign
Transcript: ENSMUST00000023269
AA Change: V148A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023269
Gene: ENSMUSG00000098274
AA Change: V148A

DomainStartEndE-ValueType
TRASH 6 44 9.53e-6 SMART
low complexity region 102 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050248
SMART Domains Protein: ENSMUSP00000056923
Gene: ENSMUSG00000022601

DomainStartEndE-ValueType
low complexity region 136 158 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
BTB 214 312 4.77e-13 SMART
low complexity region 371 399 N/A INTRINSIC
ZnF_C2H2 566 588 1.1e-2 SMART
ZnF_C2H2 594 616 2.09e-3 SMART
low complexity region 623 640 N/A INTRINSIC
ZnF_C2H2 648 670 4.47e-3 SMART
ZnF_C2H2 676 698 8.22e-2 SMART
ZnF_C2H2 704 726 2.27e-4 SMART
ZnF_C2H2 732 754 1.28e-3 SMART
ZnF_C2H2 763 785 2.95e-3 SMART
ZnF_C2H2 791 813 7.67e-2 SMART
ZnF_C2H2 819 843 2.95e-3 SMART
ZnF_C2H2 855 877 1.67e-2 SMART
ZnF_C2H2 883 905 3.02e0 SMART
ZnF_C2H2 911 934 9.58e-3 SMART
low complexity region 979 994 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122365
SMART Domains Protein: ENSMUSP00000114135
Gene: ENSMUSG00000022601

DomainStartEndE-ValueType
TRASH 6 44 9.53e-6 SMART
coiled coil region 102 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186480
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype Strain: 1856685
Lethality: E9-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L24E family of ribosomal proteins. It is located in the cytoplasm. This gene has been referred to as ribosomal protein L30 because the encoded protein shares amino acid identity with the L30 ribosomal proteins from S. cerevisiae; however, its official name is ribosomal protein L24. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous mutants have short kinked tail, ventral spotting, malocclusion, white feet, and anomalies of the spine and eyes; homozygotes die in utero. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted(1) Gene trapped(10) Spontaneous(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Rpl24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0347:Rpl24 UTSW 16 55970177 critical splice donor site probably null
R5786:Rpl24 UTSW 16 55967153 missense possibly damaging 0.51
R7252:Rpl24 UTSW 16 55970116 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GATCCCACGTTGTATCTAACTGTC -3'
(R):5'- TCAAGGAAAGCATGCAGTCTG -3'

Sequencing Primer
(F):5'- ACGTTGTATCTAACTGTCCAATCTG -3'
(R):5'- CATGCAGTCTGTGGCTAAAATGC -3'
Posted On2015-05-15