Incidental Mutation 'R4110:Slc22a12'
ID317281
Institutional Source Beutler Lab
Gene Symbol Slc22a12
Ensembl Gene ENSMUSG00000061742
Gene Namesolute carrier family 22 (organic anion/cation transporter), member 12
SynonymsRst, URAT1
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4110 (G1)
Quality Score202
Status Validated
Chromosome19
Chromosomal Location6535845-6543019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6540628 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 203 (R203L)
Ref Sequence ENSEMBL: ENSMUSP00000109078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113451] [ENSMUST00000113459]
Predicted Effect probably damaging
Transcript: ENSMUST00000113451
AA Change: R203L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109078
Gene: ENSMUSG00000061742
AA Change: R203L

DomainStartEndE-ValueType
Pfam:Sugar_tr 95 525 2e-26 PFAM
Pfam:MFS_1 128 484 7.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113459
SMART Domains Protein: ENSMUSP00000109086
Gene: ENSMUSG00000033768

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
LamG 111 238 1.26e-19 SMART
low complexity region 267 297 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126142
SMART Domains Protein: ENSMUSP00000114626
Gene: ENSMUSG00000061742

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 229 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153483
Meta Mutation Damage Score 0.706 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the organic anion transporter (OAT) family, and it acts as a urate transporter to regulate urate levels in blood. This protein is an integral membrane protein primarily found in epithelial cells of the proximal tubule of the kidney. An elevated level of serum urate, hyperuricemia, is associated with increased incidences of gout, and mutations in this gene cause renal hypouricemia type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urinary urate levels and altered urine and plasma metabolite composition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in Slc22a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Slc22a12 APN 19 6537814 missense probably benign 0.19
IGL02586:Slc22a12 APN 19 6540457 missense probably benign 0.03
R1353:Slc22a12 UTSW 19 6537782 missense possibly damaging 0.66
R1757:Slc22a12 UTSW 19 6536731 splice site probably null
R1816:Slc22a12 UTSW 19 6542653 nonsense probably null
R2254:Slc22a12 UTSW 19 6542541 missense possibly damaging 0.86
R4125:Slc22a12 UTSW 19 6538788 missense probably damaging 0.99
R4342:Slc22a12 UTSW 19 6541099 missense probably benign 0.15
R4762:Slc22a12 UTSW 19 6538444 missense probably benign 0.02
R4927:Slc22a12 UTSW 19 6537761 missense probably benign 0.23
R5690:Slc22a12 UTSW 19 6536848 missense probably benign 0.00
R5772:Slc22a12 UTSW 19 6540449 missense possibly damaging 0.67
R5946:Slc22a12 UTSW 19 6537851 missense probably damaging 1.00
R6137:Slc22a12 UTSW 19 6542724 missense probably benign 0.07
X0062:Slc22a12 UTSW 19 6537127 missense probably damaging 1.00
Z1088:Slc22a12 UTSW 19 6538463 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AAGGCGTTCAAGGTCATCACC -3'
(R):5'- CATGGGTCATGTGACTTTCTACC -3'

Sequencing Primer
(F):5'- CGTTCAAGGTCATCACCAAAGGG -3'
(R):5'- ACCTTCCTCCTCACTGGGG -3'
Posted On2015-05-15