Incidental Mutation 'R0391:Chd1'
ID31730
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission 038597-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0391 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 15749894 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 970 (G970C)
Ref Sequence ENSEMBL: ENSMUSP00000134091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
Predicted Effect probably damaging
Transcript: ENSMUST00000024627
AA Change: G970C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: G970C

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173311
AA Change: G970C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: G970C

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000174461
AA Change: G354C
SMART Domains Protein: ENSMUSP00000134718
Gene: ENSMUSG00000023852
AA Change: G354C

DomainStartEndE-ValueType
Pfam:SNF2_N 1 148 3.6e-34 PFAM
low complexity region 172 184 N/A INTRINSIC
HELICc 201 285 8.48e-25 SMART
Blast:DEXDc 340 516 1e-47 BLAST
Meta Mutation Damage Score 0.54 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,701,177 probably benign Het
Abcc2 G A 19: 43,821,605 probably benign Het
Abcc8 C G 7: 46,122,173 G838A probably damaging Het
Akr1c21 G A 13: 4,581,200 A245T probably damaging Het
Anapc15-ps T C 10: 95,673,277 E47G probably damaging Het
Apoa1 A G 9: 46,229,842 T79A probably benign Het
Atp6v1b1 A G 6: 83,756,921 H378R possibly damaging Het
C4b A G 17: 34,735,614 probably benign Het
Catsperd A T 17: 56,662,821 E638D probably benign Het
Cckar C T 5: 53,706,253 probably null Het
Cfap100 C T 6: 90,405,339 probably benign Het
Col14a1 A G 15: 55,446,259 probably benign Het
Col17a1 C T 19: 47,663,824 V698M probably damaging Het
Cpeb1 T C 7: 81,361,725 D156G possibly damaging Het
Cryl1 A G 14: 57,303,775 Y151H possibly damaging Het
Csmd3 C A 15: 47,657,573 V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 A73T probably damaging Het
Cyp2c37 T C 19: 39,994,506 S180P probably damaging Het
Cyp2c54 T C 19: 40,072,169 T123A possibly damaging Het
Dennd6b T C 15: 89,187,214 D304G probably damaging Het
Dnmt3l T C 10: 78,051,916 probably benign Het
Eci1 G A 17: 24,433,260 probably null Het
Efhc1 A G 1: 20,960,188 Y115C probably damaging Het
Ern1 T A 11: 106,407,178 K706* probably null Het
Fam129c T A 8: 71,602,499 probably benign Het
Ghrl T C 6: 113,719,338 E31G probably damaging Het
Gpr108 A C 17: 57,243,101 V179G probably benign Het
Henmt1 A G 3: 108,958,535 probably benign Het
Ift172 A G 5: 31,286,667 V69A probably damaging Het
Il17ra T C 6: 120,476,979 probably benign Het
Il17rb T C 14: 30,004,347 N95D probably benign Het
Il17rb G T 14: 30,006,155 probably null Het
Iqub G A 6: 24,446,155 L757F probably benign Het
Itpr1 T C 6: 108,378,167 V473A probably benign Het
Itpr2 T G 6: 146,229,773 N1978H probably damaging Het
Klk1b26 T A 7: 44,012,727 F3Y probably damaging Het
Lars A G 18: 42,251,363 V50A probably benign Het
Lax1 G T 1: 133,680,066 H312Q probably benign Het
Lctl T C 9: 64,122,314 probably benign Het
Lrp2 T A 2: 69,456,858 D3745V probably damaging Het
Lrp2 G A 2: 69,460,337 probably benign Het
Lvrn A T 18: 46,850,466 H92L probably benign Het
March1 A G 8: 66,418,973 T385A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mbd5 T C 2: 49,272,416 V970A possibly damaging Het
Mccc1 A G 3: 35,963,570 probably benign Het
Mpp4 A T 1: 59,143,829 probably benign Het
Mrnip G A 11: 50,199,920 A304T probably damaging Het
Muc5b T C 7: 141,865,082 S3922P possibly damaging Het
Myh3 T A 11: 67,096,507 probably benign Het
Nbea A T 3: 56,037,277 H555Q probably damaging Het
Nlrp9c A T 7: 26,371,476 probably benign Het
Nmur1 A T 1: 86,387,678 V178E probably damaging Het
Nod2 T G 8: 88,663,778 S238A probably benign Het
Ogfod1 A T 8: 94,063,023 T451S probably damaging Het
Olfr145 G A 9: 37,897,842 G146D probably benign Het
Olfr23 T C 11: 73,941,109 F288L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr716 T A 7: 107,148,187 Y290* probably null Het
Pcdh20 T C 14: 88,468,668 I399V probably benign Het
Pdlim1 G T 19: 40,243,573 H120Q probably damaging Het
Plg T C 17: 12,419,081 V798A probably damaging Het
Polr2c A G 8: 94,857,775 I39V possibly damaging Het
Ppfia2 C A 10: 106,830,714 probably benign Het
Ppp1r3a A T 6: 14,719,697 I406N probably benign Het
Psg28 A T 7: 18,426,173 M366K probably benign Het
Rad54b T C 4: 11,601,702 I419T probably damaging Het
Rnf43 A G 11: 87,731,282 Q403R possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc28a3 A G 13: 58,569,415 probably benign Het
Smad2 A T 18: 76,289,037 probably null Het
Smad4 G A 18: 73,658,649 P274S probably benign Het
Smchd1 A T 17: 71,403,154 V906D probably damaging Het
Soat2 C A 15: 102,158,753 R320S possibly damaging Het
Spata33 C T 8: 123,221,887 A57V probably damaging Het
Stab1 A G 14: 31,143,418 L1814P probably benign Het
Stab2 T C 10: 86,947,144 K680R probably benign Het
Stil A G 4: 115,041,172 probably null Het
Sympk T A 7: 19,046,849 L759H probably benign Het
Tet1 A T 10: 62,814,546 probably null Het
Tfpi2 A T 6: 3,965,460 N117K probably benign Het
Tle3 A G 9: 61,416,661 Y766C probably damaging Het
Trpt1 C A 19: 6,997,930 probably null Het
Tshz1 A G 18: 84,016,049 F78S possibly damaging Het
Ttc1 T C 11: 43,738,808 D177G probably damaging Het
Ttc13 T A 8: 124,674,401 Y741F probably damaging Het
Ulk3 C T 9: 57,594,832 S462L probably benign Het
Utrn C T 10: 12,525,333 probably benign Het
V1rd19 A C 7: 24,003,585 T159P probably damaging Het
Vars T C 17: 35,011,486 V515A possibly damaging Het
Vmn1r85 A G 7: 13,084,588 Y210H probably benign Het
Vmn2r89 A G 14: 51,455,978 T262A probably damaging Het
Vps53 G A 11: 76,121,579 T209I probably benign Het
Wdfy2 T C 14: 62,925,133 F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 S694Y probably damaging Het
Zbtb8b T A 4: 129,432,670 D201V probably damaging Het
Zmym5 A C 14: 56,804,451 N123K possibly damaging Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 intron probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGATACCACTGGGAAGACAGTGC -3'
(R):5'- ACTAGCTCAACCCTCAGCAGTGTG -3'

Sequencing Primer
(F):5'- GCTTGACTGTTACAGATAGATCGC -3'
(R):5'- GAGTCTCGGCTCTCTTCAGG -3'
Posted On2013-04-24