Incidental Mutation 'R4111:Dclk3'
ID317321
Institutional Source Beutler Lab
Gene Symbol Dclk3
Ensembl Gene ENSMUSG00000032500
Gene Namedoublecortin-like kinase 3
SynonymsClick-I, -II related, Dcamkl3
Accession Numbers

Genbank: NM_172928; MGI: 3039580

Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R4111 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location111439081-111489118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111469080 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 564 (I564T)
Ref Sequence ENSEMBL: ENSMUSP00000107510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111879]
Predicted Effect probably damaging
Transcript: ENSMUST00000111879
AA Change: I564T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107510
Gene: ENSMUSG00000032500
AA Change: I564T

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:DCX 115 177 2.9e-17 PFAM
low complexity region 200 218 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
S_TKc 514 771 1.63e-110 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. Differently from the other two closely related family members (DCLK1 and DCLK2), the protein encoded by this gene contains only one N-terminal doublecortin domain and is unable to bind microtubules and to regulate microtubule polymerization. The protein contains a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. [provided by RefSeq, Sep 2010]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Ambra1 T C 2: 91,900,558 S894P probably damaging Het
Arhgef12 C A 9: 42,972,274 G1320C probably damaging Het
Atg7 G C 6: 114,713,294 G596R probably damaging Het
AY761184 T C 8: 21,702,663 T106A possibly damaging Het
Birc6 T C 17: 74,566,015 V423A probably damaging Het
Cdh17 T C 4: 11,814,628 S728P probably damaging Het
Ctu2 G A 8: 122,476,517 R24Q possibly damaging Het
Ddx39b T A 17: 35,243,364 I42N possibly damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dzip1 T A 14: 118,877,233 K837* probably null Het
Epha1 G A 6: 42,358,838 T955M possibly damaging Het
Etfbkmt T C 6: 149,144,591 probably benign Het
Etfrf1 T C 6: 145,215,372 Y23H probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12355 A T 11: 98,625,397 V50D probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gpr37l1 T C 1: 135,167,270 T79A possibly damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Ifnar1 C A 16: 91,496,158 P230T probably damaging Het
Impact T C 18: 12,976,033 probably null Het
Kcna6 G C 6: 126,739,774 R51G probably damaging Het
Lrpprc G A 17: 84,726,338 T1037M probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr1440 T C 19: 12,394,301 F13L probably damaging Het
Olfr430 T A 1: 174,069,433 I45N probably damaging Het
Olfr979 C A 9: 40,000,898 E110* probably null Het
Pask A G 1: 93,310,818 V1315A probably damaging Het
Pramef25 T A 4: 143,949,905 I210F possibly damaging Het
Prl7a2 A T 13: 27,665,067 Y80N possibly damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Rtn2 T C 7: 19,286,844 S81P probably damaging Het
Sbf2 G A 7: 110,428,242 P470S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sox30 A G 11: 46,017,214 Y736C probably benign Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Tns1 T C 1: 73,941,932 N1091S probably damaging Het
Trappc10 A G 10: 78,196,430 F1008S probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Uhrf1bp1 T A 17: 27,886,090 L586* probably null Het
Vmn1r122 A T 7: 21,133,513 S206T probably damaging Het
Vmn2r1 A C 3: 64,089,755 K277N probably benign Het
Vps13a T C 19: 16,640,628 E2931G probably damaging Het
Wdr70 G T 15: 7,976,991 Q360K probably benign Het
Wdr90 G T 17: 25,849,368 Q1329K possibly damaging Het
Wrn T C 8: 33,352,155 N37S probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp964 T A 8: 69,664,104 S450R probably benign Het
Zkscan2 T C 7: 123,482,684 probably benign Het
Zmynd10 A T 9: 107,549,052 K133* probably null Het
Other mutations in Dclk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Dclk3 APN 9 111467843 nonsense probably null
IGL02125:Dclk3 APN 9 111469107 missense probably damaging 1.00
IGL02547:Dclk3 APN 9 111469023 missense probably damaging 1.00
IGL03393:Dclk3 APN 9 111488673 utr 3 prime probably benign
IGL02984:Dclk3 UTSW 9 111488575 missense probably damaging 1.00
R0109:Dclk3 UTSW 9 111467670 missense possibly damaging 0.93
R0109:Dclk3 UTSW 9 111467670 missense possibly damaging 0.93
R0238:Dclk3 UTSW 9 111482628 missense probably damaging 0.99
R0238:Dclk3 UTSW 9 111482628 missense probably damaging 0.99
R0432:Dclk3 UTSW 9 111484935 missense probably damaging 1.00
R0440:Dclk3 UTSW 9 111469163 missense probably damaging 1.00
R0530:Dclk3 UTSW 9 111482721 missense probably damaging 1.00
R1024:Dclk3 UTSW 9 111469070 missense possibly damaging 0.95
R1443:Dclk3 UTSW 9 111469020 missense probably benign 0.01
R1474:Dclk3 UTSW 9 111469236 missense probably benign 0.43
R1479:Dclk3 UTSW 9 111468546 missense probably benign
R1482:Dclk3 UTSW 9 111467820 missense possibly damaging 0.90
R1543:Dclk3 UTSW 9 111468054 missense probably benign 0.04
R1552:Dclk3 UTSW 9 111488579 missense probably damaging 1.00
R1559:Dclk3 UTSW 9 111469208 missense probably damaging 1.00
R2011:Dclk3 UTSW 9 111468354 missense probably benign 0.00
R2369:Dclk3 UTSW 9 111488542 missense probably benign 0.16
R4510:Dclk3 UTSW 9 111467992 missense probably benign 0.01
R4511:Dclk3 UTSW 9 111467992 missense probably benign 0.01
R4592:Dclk3 UTSW 9 111467895 missense probably damaging 1.00
R4604:Dclk3 UTSW 9 111469185 missense probably damaging 1.00
R4857:Dclk3 UTSW 9 111468648 missense probably benign
R4932:Dclk3 UTSW 9 111468042 missense possibly damaging 0.56
R5045:Dclk3 UTSW 9 111467788 missense probably damaging 0.99
R5233:Dclk3 UTSW 9 111468681 missense probably benign
R5338:Dclk3 UTSW 9 111469059 missense possibly damaging 0.95
R5463:Dclk3 UTSW 9 111469260 missense probably benign 0.26
R6822:Dclk3 UTSW 9 111439337 missense probably benign 0.03
X0020:Dclk3 UTSW 9 111485075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCATCTCAGCGGATGTGG -3'
(R):5'- CCAGGAGGTTTTCTGGTTTCAC -3'

Sequencing Primer
(F):5'- TCATCTCAGCGGATGTGGAGAAG -3'
(R):5'- GACGAGGGCCTTACACAAGTC -3'
Posted On2015-05-15