Incidental Mutation 'R0391:Smad2'
ID31738
Institutional Source Beutler Lab
Gene Symbol Smad2
Ensembl Gene ENSMUSG00000024563
Gene NameSMAD family member 2
SynonymsSmad 2, Madr2, 7120426M23Rik, Madh2
MMRRC Submission 038597-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0391 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location76241580-76305731 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 76289037 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025453] [ENSMUST00000091831] [ENSMUST00000113930] [ENSMUST00000165084] [ENSMUST00000168423] [ENSMUST00000171256] [ENSMUST00000172198]
Predicted Effect probably null
Transcript: ENSMUST00000025453
SMART Domains Protein: ENSMUSP00000025453
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWB 230 261 2e-10 BLAST
DWB 272 443 2.25e-108 SMART
Predicted Effect probably null
Transcript: ENSMUST00000091831
SMART Domains Protein: ENSMUSP00000089439
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 144 1.68e-66 SMART
Blast:DWB 200 231 1e-10 BLAST
DWB 242 413 2.25e-108 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113930
SMART Domains Protein: ENSMUSP00000109563
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 144 1.68e-66 SMART
Blast:DWB 200 231 9e-11 BLAST
DWB 242 408 4.38e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165084
SMART Domains Protein: ENSMUSP00000132851
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 144 7.85e-67 SMART
PDB:1KHX|A 166 204 3e-19 PDB
SCOP:d1khxa_ 190 204 7e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168423
SMART Domains Protein: ENSMUSP00000130115
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWB 230 261 2e-10 BLAST
DWB 272 443 2.25e-108 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171256
SMART Domains Protein: ENSMUSP00000125883
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWA 182 213 3e-13 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000172198
SMART Domains Protein: ENSMUSP00000129232
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
Pfam:MH2 28 58 1.8e-10 PFAM
Meta Mutation Damage Score 0.584 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutant embryos die at day 6.5-8.5 with multiple defects, including failed gastrulation, lack of mesoderm, visceral endoderm dysfunction and failure to form anterior-posterior axis. Heterozygotes may show gastrulation defects and lack mandible or eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,701,177 probably benign Het
Abcc2 G A 19: 43,821,605 probably benign Het
Abcc8 C G 7: 46,122,173 G838A probably damaging Het
Akr1c21 G A 13: 4,581,200 A245T probably damaging Het
Anapc15-ps T C 10: 95,673,277 E47G probably damaging Het
Apoa1 A G 9: 46,229,842 T79A probably benign Het
Atp6v1b1 A G 6: 83,756,921 H378R possibly damaging Het
C4b A G 17: 34,735,614 probably benign Het
Catsperd A T 17: 56,662,821 E638D probably benign Het
Cckar C T 5: 53,706,253 probably null Het
Cfap100 C T 6: 90,405,339 probably benign Het
Chd1 G T 17: 15,749,894 G970C probably damaging Het
Col14a1 A G 15: 55,446,259 probably benign Het
Col17a1 C T 19: 47,663,824 V698M probably damaging Het
Cpeb1 T C 7: 81,361,725 D156G possibly damaging Het
Cryl1 A G 14: 57,303,775 Y151H possibly damaging Het
Csmd3 C A 15: 47,657,573 V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 A73T probably damaging Het
Cyp2c37 T C 19: 39,994,506 S180P probably damaging Het
Cyp2c54 T C 19: 40,072,169 T123A possibly damaging Het
Dennd6b T C 15: 89,187,214 D304G probably damaging Het
Dnmt3l T C 10: 78,051,916 probably benign Het
Eci1 G A 17: 24,433,260 probably null Het
Efhc1 A G 1: 20,960,188 Y115C probably damaging Het
Ern1 T A 11: 106,407,178 K706* probably null Het
Fam129c T A 8: 71,602,499 probably benign Het
Ghrl T C 6: 113,719,338 E31G probably damaging Het
Gpr108 A C 17: 57,243,101 V179G probably benign Het
Henmt1 A G 3: 108,958,535 probably benign Het
Ift172 A G 5: 31,286,667 V69A probably damaging Het
Il17ra T C 6: 120,476,979 probably benign Het
Il17rb T C 14: 30,004,347 N95D probably benign Het
Il17rb G T 14: 30,006,155 probably null Het
Iqub G A 6: 24,446,155 L757F probably benign Het
Itpr1 T C 6: 108,378,167 V473A probably benign Het
Itpr2 T G 6: 146,229,773 N1978H probably damaging Het
Klk1b26 T A 7: 44,012,727 F3Y probably damaging Het
Lars A G 18: 42,251,363 V50A probably benign Het
Lax1 G T 1: 133,680,066 H312Q probably benign Het
Lctl T C 9: 64,122,314 probably benign Het
Lrp2 T A 2: 69,456,858 D3745V probably damaging Het
Lrp2 G A 2: 69,460,337 probably benign Het
Lvrn A T 18: 46,850,466 H92L probably benign Het
March1 A G 8: 66,418,973 T385A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mbd5 T C 2: 49,272,416 V970A possibly damaging Het
Mccc1 A G 3: 35,963,570 probably benign Het
Mpp4 A T 1: 59,143,829 probably benign Het
Mrnip G A 11: 50,199,920 A304T probably damaging Het
Muc5b T C 7: 141,865,082 S3922P possibly damaging Het
Myh3 T A 11: 67,096,507 probably benign Het
Nbea A T 3: 56,037,277 H555Q probably damaging Het
Nlrp9c A T 7: 26,371,476 probably benign Het
Nmur1 A T 1: 86,387,678 V178E probably damaging Het
Nod2 T G 8: 88,663,778 S238A probably benign Het
Ogfod1 A T 8: 94,063,023 T451S probably damaging Het
Olfr145 G A 9: 37,897,842 G146D probably benign Het
Olfr23 T C 11: 73,941,109 F288L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr716 T A 7: 107,148,187 Y290* probably null Het
Pcdh20 T C 14: 88,468,668 I399V probably benign Het
Pdlim1 G T 19: 40,243,573 H120Q probably damaging Het
Plg T C 17: 12,419,081 V798A probably damaging Het
Polr2c A G 8: 94,857,775 I39V possibly damaging Het
Ppfia2 C A 10: 106,830,714 probably benign Het
Ppp1r3a A T 6: 14,719,697 I406N probably benign Het
Psg28 A T 7: 18,426,173 M366K probably benign Het
Rad54b T C 4: 11,601,702 I419T probably damaging Het
Rnf43 A G 11: 87,731,282 Q403R possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc28a3 A G 13: 58,569,415 probably benign Het
Smad4 G A 18: 73,658,649 P274S probably benign Het
Smchd1 A T 17: 71,403,154 V906D probably damaging Het
Soat2 C A 15: 102,158,753 R320S possibly damaging Het
Spata33 C T 8: 123,221,887 A57V probably damaging Het
Stab1 A G 14: 31,143,418 L1814P probably benign Het
Stab2 T C 10: 86,947,144 K680R probably benign Het
Stil A G 4: 115,041,172 probably null Het
Sympk T A 7: 19,046,849 L759H probably benign Het
Tet1 A T 10: 62,814,546 probably null Het
Tfpi2 A T 6: 3,965,460 N117K probably benign Het
Tle3 A G 9: 61,416,661 Y766C probably damaging Het
Trpt1 C A 19: 6,997,930 probably null Het
Tshz1 A G 18: 84,016,049 F78S possibly damaging Het
Ttc1 T C 11: 43,738,808 D177G probably damaging Het
Ttc13 T A 8: 124,674,401 Y741F probably damaging Het
Ulk3 C T 9: 57,594,832 S462L probably benign Het
Utrn C T 10: 12,525,333 probably benign Het
V1rd19 A C 7: 24,003,585 T159P probably damaging Het
Vars T C 17: 35,011,486 V515A possibly damaging Het
Vmn1r85 A G 7: 13,084,588 Y210H probably benign Het
Vmn2r89 A G 14: 51,455,978 T262A probably damaging Het
Vps53 G A 11: 76,121,579 T209I probably benign Het
Wdfy2 T C 14: 62,925,133 F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 S694Y probably damaging Het
Zbtb8b T A 4: 129,432,670 D201V probably damaging Het
Zmym5 A C 14: 56,804,451 N123K possibly damaging Het
Other mutations in Smad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Smad2 APN 18 76298495 missense possibly damaging 0.94
IGL00978:Smad2 APN 18 76299775 splice site probably benign
IGL01295:Smad2 APN 18 76302430 missense probably benign 0.05
IGL01887:Smad2 APN 18 76299894 missense probably damaging 1.00
IGL01960:Smad2 APN 18 76262484 intron probably benign
IGL02881:Smad2 APN 18 76299780 splice site probably null
IGL02977:Smad2 APN 18 76289164 missense possibly damaging 0.64
R0333:Smad2 UTSW 18 76262621 missense probably damaging 1.00
R0523:Smad2 UTSW 18 76262552 missense probably benign
R0570:Smad2 UTSW 18 76289179 splice site probably benign
R0624:Smad2 UTSW 18 76299993 missense probably damaging 1.00
R1573:Smad2 UTSW 18 76262586 missense possibly damaging 0.89
R1953:Smad2 UTSW 18 76262705 missense possibly damaging 0.90
R2132:Smad2 UTSW 18 76288084 nonsense probably null
R2213:Smad2 UTSW 18 76304626 missense probably damaging 1.00
R3021:Smad2 UTSW 18 76262632 missense probably damaging 1.00
R3917:Smad2 UTSW 18 76287937 missense probably benign 0.42
R4503:Smad2 UTSW 18 76302592 missense probably benign 0.23
R5253:Smad2 UTSW 18 76288053 missense probably damaging 1.00
R5290:Smad2 UTSW 18 76262724 missense probably damaging 1.00
R5891:Smad2 UTSW 18 76299975 missense probably damaging 1.00
R6294:Smad2 UTSW 18 76289162 missense probably benign 0.31
R6879:Smad2 UTSW 18 76262654 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATTTGACAGGGTCACATTGTTCTCCAA -3'
(R):5'- AACCACATTACTAACACCTGGGCATTT -3'

Sequencing Primer
(F):5'- TAGGTGTGGCCAGACTGAAA -3'
(R):5'- ACTAACACCTGGGCATTTGTTAC -3'
Posted On2013-04-24