Incidental Mutation 'R4089:Frem3'
ID317512
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission 040982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4089 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80615173 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1365 (F1365S)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably damaging
Transcript: ENSMUST00000039695
AA Change: F1365S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: F1365S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Actr5 T C 2: 158,625,102 probably benign Het
Arhgef17 T A 7: 100,883,799 E1173V probably damaging Het
Brca1 T C 11: 101,524,176 N1044S possibly damaging Het
Cap1 A G 4: 122,862,409 V398A probably benign Het
Cbs A C 17: 31,633,006 C8G probably benign Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dip2a T C 10: 76,278,489 probably null Het
Dock9 A T 14: 121,583,471 C1494S probably damaging Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fbn2 C T 18: 58,053,769 D1687N probably benign Het
Flt1 C A 5: 147,564,241 L1327F probably benign Het
Gigyf2 A G 1: 87,443,672 E1169G probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm14443 T C 2: 175,171,892 Y29C probably damaging Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Ifngr1 T C 10: 19,601,485 probably null Het
Il31ra C T 13: 112,551,919 W41* probably null Het
Ints4 T A 7: 97,529,255 Y687* probably null Het
Jpt2 A G 17: 24,956,102 S37P probably benign Het
Kcnk9 A G 15: 72,546,263 V6A probably benign Het
Lamc3 C T 2: 31,920,508 R797* probably null Het
Lrig1 A G 6: 94,609,859 I612T possibly damaging Het
Mapk4 C A 18: 73,930,459 C564F probably damaging Het
Marveld2 T A 13: 100,600,480 H215L probably benign Het
Mindy3 T C 2: 12,364,516 M84V probably benign Het
Nek3 T C 8: 22,149,913 D182G probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Pkp3 G A 7: 141,084,143 R411H probably damaging Het
Plau A G 14: 20,841,066 D366G probably damaging Het
Prkd3 A G 17: 78,971,388 M423T possibly damaging Het
Prmt9 A T 8: 77,572,545 I623L probably benign Het
Rgs6 A T 12: 83,063,487 E175D probably damaging Het
Rnf135 G A 11: 80,199,046 G403S probably damaging Het
Scn11a C T 9: 119,795,653 probably null Het
Snap23 C T 2: 120,584,375 probably benign Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Sox10 C T 15: 79,156,363 V165M possibly damaging Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Tex14 A G 11: 87,512,203 D533G probably damaging Het
Topbp1 T C 9: 103,324,501 probably null Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Trip4 A G 9: 65,858,283 V378A probably benign Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Washc2 A T 6: 116,256,292 probably null Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 intron probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATGATGAGGTTCCTCAGTTGACC -3'
(R):5'- GTCAAGGTGACTCTTTTGCTGAC -3'

Sequencing Primer
(F):5'- GAGGTTCCTCAGTTGACCATCAATG -3'
(R):5'- TGCTGACTATCTCAGGGACG -3'
Posted On2015-05-15