Incidental Mutation 'R0392:Cd53'
ID 31752
Institutional Source Beutler Lab
Gene Symbol Cd53
Ensembl Gene ENSMUSG00000040747
Gene Name CD53 antigen
Synonyms Tspan25, Ox-44
MMRRC Submission 038598-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.206) question?
Stock # R0392 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 106667237-106697465 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106670592 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 147 (V147E)
Ref Sequence ENSEMBL: ENSMUSP00000035781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038845]
AlphaFold Q61451
Predicted Effect probably damaging
Transcript: ENSMUST00000038845
AA Change: V147E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035781
Gene: ENSMUSG00000040747
AA Change: V147E

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 210 4.6e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. It contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation. Familial deficiency of this gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: B cells lacking this gene exhibit impaired PKC recruitment to the plasma membrane and phosphorylation of PKC substrates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930527J03Rik ACCC ACC 1: 178,276,503 (GRCm38) noncoding transcript Het
Bcan T A 3: 87,900,869 (GRCm39) K455* probably null Het
Casp12 T A 9: 5,348,973 (GRCm39) probably benign Het
Ccdc61 T C 7: 18,625,027 (GRCm39) M504V probably benign Het
Cyp2b13 T C 7: 25,785,308 (GRCm39) Y226H probably benign Het
Cyp2j7 T C 4: 96,087,671 (GRCm39) D413G probably damaging Het
Dcbld1 T C 10: 52,193,230 (GRCm39) I254T possibly damaging Het
Ddx39a T G 8: 84,448,366 (GRCm39) M206R probably damaging Het
Dgki T A 6: 36,977,113 (GRCm39) T666S probably damaging Het
Dnaaf8 T C 16: 4,795,363 (GRCm39) noncoding transcript Het
Dnah7a C A 1: 53,543,357 (GRCm39) C2271F probably damaging Het
Emilin3 A G 2: 160,752,799 (GRCm39) probably benign Het
Epha4 T C 1: 77,483,610 (GRCm39) K133R probably benign Het
Gm11146 T A 16: 77,394,054 (GRCm39) probably benign Het
Ift88 A T 14: 57,733,617 (GRCm39) probably benign Het
Ighv10-3 A G 12: 114,487,460 (GRCm39) probably benign Het
Lamp5 T C 2: 135,902,817 (GRCm39) S179P probably damaging Het
Map4 T C 9: 109,907,113 (GRCm39) S788P probably damaging Het
Or5m13 T A 2: 85,749,106 (GRCm39) I279N possibly damaging Het
Otog T C 7: 45,899,499 (GRCm39) W267R probably benign Het
Pafah1b2 T C 9: 45,880,151 (GRCm39) I175M probably benign Het
Pcdhb12 A G 18: 37,570,011 (GRCm39) K386E possibly damaging Het
Pcnt T C 10: 76,220,660 (GRCm39) N2056S probably benign Het
Pold2 T C 11: 5,826,776 (GRCm39) I53V possibly damaging Het
Rsf1 T A 7: 97,328,212 (GRCm39) D1071E probably benign Het
Rtp3 A T 9: 110,818,621 (GRCm39) M20K probably damaging Het
S1pr5 T A 9: 21,156,277 (GRCm39) I50F probably damaging Het
Slc47a1 A G 11: 61,262,608 (GRCm39) S94P probably damaging Het
Slitrk5 G A 14: 111,916,465 (GRCm39) V30I probably benign Het
St8sia5 G A 18: 77,342,102 (GRCm39) V271M probably damaging Het
Sult2b1 G T 7: 45,383,062 (GRCm39) T240N probably damaging Het
Other mutations in Cd53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02500:Cd53 APN 3 106,676,142 (GRCm39) missense probably damaging 1.00
IGL02592:Cd53 APN 3 106,670,601 (GRCm39) missense probably damaging 1.00
R0090:Cd53 UTSW 3 106,674,725 (GRCm39) missense possibly damaging 0.94
R0538:Cd53 UTSW 3 106,669,444 (GRCm39) missense probably benign 0.07
R1452:Cd53 UTSW 3 106,676,275 (GRCm39) missense probably damaging 1.00
R1693:Cd53 UTSW 3 106,676,205 (GRCm39) missense possibly damaging 0.66
R2042:Cd53 UTSW 3 106,674,740 (GRCm39) critical splice acceptor site probably null
R2300:Cd53 UTSW 3 106,670,572 (GRCm39) missense probably benign
R2878:Cd53 UTSW 3 106,674,732 (GRCm39) missense probably benign 0.00
R4081:Cd53 UTSW 3 106,669,461 (GRCm39) missense probably benign
R6180:Cd53 UTSW 3 106,674,680 (GRCm39) missense probably damaging 0.96
R6519:Cd53 UTSW 3 106,669,461 (GRCm39) missense probably benign 0.00
R6694:Cd53 UTSW 3 106,674,702 (GRCm39) missense probably benign 0.03
R7043:Cd53 UTSW 3 106,670,577 (GRCm39) missense probably damaging 1.00
R7417:Cd53 UTSW 3 106,676,235 (GRCm39) missense probably benign 0.17
R7736:Cd53 UTSW 3 106,675,252 (GRCm39) missense probably benign 0.12
R7893:Cd53 UTSW 3 106,674,702 (GRCm39) missense probably benign 0.03
R9493:Cd53 UTSW 3 106,674,683 (GRCm39) missense probably null 0.66
Predicted Primers PCR Primer
(F):5'- AAGGAATGGATCTGCCTTCTCCAAAAG -3'
(R):5'- TGCATAAGCGGAGCATGTCATTTAAAC -3'

Sequencing Primer
(F):5'- GCTCCTAGATTTTGGAAGCATC -3'
(R):5'- ATGAACATTTAGTTCCAAAGAGTCTG -3'
Posted On 2013-04-24