Incidental Mutation 'R4089:Prkd3'
ID317536
Institutional Source Beutler Lab
Gene Symbol Prkd3
Ensembl Gene ENSMUSG00000024070
Gene Nameprotein kinase D3
SynonymsPrkcn, 5730497N19Rik, PKD3, 4930557O20Rik
MMRRC Submission 040982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R4089 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location78949405-79020816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78971388 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 423 (M423T)
Ref Sequence ENSEMBL: ENSMUSP00000132004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003191] [ENSMUST00000118768] [ENSMUST00000118991] [ENSMUST00000119284] [ENSMUST00000168887]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003191
AA Change: M423T

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000003191
Gene: ENSMUSG00000024070
AA Change: M423T

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118768
AA Change: M328T

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113232
Gene: ENSMUSG00000024070
AA Change: M328T

DomainStartEndE-ValueType
C1 60 109 1.95e-13 SMART
C1 177 226 1.26e-16 SMART
PH 322 439 1.18e-10 SMART
S_TKc 481 737 4.5e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118991
SMART Domains Protein: ENSMUSP00000112775
Gene: ENSMUSG00000024070

DomainStartEndE-ValueType
C1 51 100 1.95e-13 SMART
C1 168 217 1.26e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119284
AA Change: M423T

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113395
Gene: ENSMUSG00000024070
AA Change: M423T

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 576 832 4.5e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146917
Predicted Effect possibly damaging
Transcript: ENSMUST00000168887
AA Change: M423T

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132004
Gene: ENSMUSG00000024070
AA Change: M423T

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Meta Mutation Damage Score 0.412 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the multigene protein kinase D family of serine/threonine kinases, which bind diacylglycerol and phorbol esters. Members of this family are characterized by an N-terminal regulatory domain comprised of a tandem repeat of cysteine-rich zinc-finger motifs and a pleckstrin domain. The C-terminal region contains the catalytic domain and is distantly related to calcium-regulated kinases. Catalytic activity of this enzyme promotes its nuclear localization. This protein has been implicated in a variety of functions including negative regulation of human airway epithelial barrier formation, growth regulation of breast and prostate cancer cells, and vesicle trafficking. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal vertebral trabecular bone morphology and abnormal femur morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Actr5 T C 2: 158,625,102 probably benign Het
Arhgef17 T A 7: 100,883,799 E1173V probably damaging Het
Brca1 T C 11: 101,524,176 N1044S possibly damaging Het
Cap1 A G 4: 122,862,409 V398A probably benign Het
Cbs A C 17: 31,633,006 C8G probably benign Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dip2a T C 10: 76,278,489 probably null Het
Dock9 A T 14: 121,583,471 C1494S probably damaging Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fbn2 C T 18: 58,053,769 D1687N probably benign Het
Flt1 C A 5: 147,564,241 L1327F probably benign Het
Frem3 T C 8: 80,615,173 F1365S probably damaging Het
Gigyf2 A G 1: 87,443,672 E1169G probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm14443 T C 2: 175,171,892 Y29C probably damaging Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Ifngr1 T C 10: 19,601,485 probably null Het
Il31ra C T 13: 112,551,919 W41* probably null Het
Ints4 T A 7: 97,529,255 Y687* probably null Het
Jpt2 A G 17: 24,956,102 S37P probably benign Het
Kcnk9 A G 15: 72,546,263 V6A probably benign Het
Lamc3 C T 2: 31,920,508 R797* probably null Het
Lrig1 A G 6: 94,609,859 I612T possibly damaging Het
Mapk4 C A 18: 73,930,459 C564F probably damaging Het
Marveld2 T A 13: 100,600,480 H215L probably benign Het
Mindy3 T C 2: 12,364,516 M84V probably benign Het
Nek3 T C 8: 22,149,913 D182G probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Pkp3 G A 7: 141,084,143 R411H probably damaging Het
Plau A G 14: 20,841,066 D366G probably damaging Het
Prmt9 A T 8: 77,572,545 I623L probably benign Het
Rgs6 A T 12: 83,063,487 E175D probably damaging Het
Rnf135 G A 11: 80,199,046 G403S probably damaging Het
Scn11a C T 9: 119,795,653 probably null Het
Snap23 C T 2: 120,584,375 probably benign Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Sox10 C T 15: 79,156,363 V165M possibly damaging Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Tex14 A G 11: 87,512,203 D533G probably damaging Het
Topbp1 T C 9: 103,324,501 probably null Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Trip4 A G 9: 65,858,283 V378A probably benign Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Washc2 A T 6: 116,256,292 probably null Het
Other mutations in Prkd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Prkd3 APN 17 78954523 missense probably benign 0.00
IGL01775:Prkd3 APN 17 79012760 missense probably damaging 1.00
IGL01875:Prkd3 APN 17 78957206 missense possibly damaging 0.95
IGL01892:Prkd3 APN 17 78972501 missense probably benign 0.13
FR4304:Prkd3 UTSW 17 78975820 intron probably null
R0070:Prkd3 UTSW 17 78954510 missense probably damaging 1.00
R0070:Prkd3 UTSW 17 78954510 missense probably damaging 1.00
R0374:Prkd3 UTSW 17 78957215 missense probably null 1.00
R0688:Prkd3 UTSW 17 78957233 missense probably damaging 0.99
R1112:Prkd3 UTSW 17 78966408 missense probably damaging 1.00
R1364:Prkd3 UTSW 17 78957258 missense probably damaging 1.00
R1382:Prkd3 UTSW 17 78957245 missense probably damaging 1.00
R1459:Prkd3 UTSW 17 78971367 missense probably damaging 1.00
R1522:Prkd3 UTSW 17 78952696 missense probably damaging 1.00
R1645:Prkd3 UTSW 17 78956520 critical splice donor site probably null
R2035:Prkd3 UTSW 17 78975373 critical splice donor site probably null
R2187:Prkd3 UTSW 17 78975554 missense probably benign
R2250:Prkd3 UTSW 17 78968078 missense probably benign 0.15
R2850:Prkd3 UTSW 17 78954596 missense possibly damaging 0.89
R3625:Prkd3 UTSW 17 78985304 missense probably damaging 1.00
R3773:Prkd3 UTSW 17 78959106 missense possibly damaging 0.52
R3973:Prkd3 UTSW 17 78959141 splice site probably benign
R4407:Prkd3 UTSW 17 78983558 missense probably damaging 1.00
R4453:Prkd3 UTSW 17 78983546 missense probably damaging 1.00
R4697:Prkd3 UTSW 17 78961171 missense probably benign 0.02
R4715:Prkd3 UTSW 17 78951937 missense possibly damaging 0.73
R4754:Prkd3 UTSW 17 78956614 missense probably damaging 1.00
R4955:Prkd3 UTSW 17 78952727 missense probably null 0.95
R5412:Prkd3 UTSW 17 78954711 missense possibly damaging 0.85
R6163:Prkd3 UTSW 17 78966355 missense possibly damaging 0.94
R6280:Prkd3 UTSW 17 78981931 missense probably damaging 0.97
R7074:Prkd3 UTSW 17 78974807 nonsense probably null
R7153:Prkd3 UTSW 17 78966355 missense probably benign 0.04
R7335:Prkd3 UTSW 17 78954566 missense probably damaging 0.99
X0063:Prkd3 UTSW 17 78956613 missense probably damaging 1.00
X0066:Prkd3 UTSW 17 78961182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTGACGATCATTCTAGCATAGC -3'
(R):5'- ACTACATGTCAGTGTAACAGAGC -3'

Sequencing Primer
(F):5'- GCTTTTGCACACTGCTGTAG -3'
(R):5'- AGCTCAGTTATGTTTTAGAAACTGGG -3'
Posted On2015-05-15