Incidental Mutation 'R4090:Rbm47'
ID317555
Institutional Source Beutler Lab
Gene Symbol Rbm47
Ensembl Gene ENSMUSG00000070780
Gene NameRNA binding motif protein 47
Synonyms
MMRRC Submission 040983-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R4090 (G1)
Quality Score223
Status Validated
Chromosome5
Chromosomal Location66016549-66173118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66022737 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 409 (M409T)
Ref Sequence ENSEMBL: ENSMUSP00000092348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094756] [ENSMUST00000094757] [ENSMUST00000113724] [ENSMUST00000113726] [ENSMUST00000167950] [ENSMUST00000200775] [ENSMUST00000200852] [ENSMUST00000201544] [ENSMUST00000201561] [ENSMUST00000202700]
Predicted Effect probably benign
Transcript: ENSMUST00000094756
AA Change: M409T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000092348
Gene: ENSMUSG00000070780
AA Change: M409T

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094757
AA Change: M478T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000092349
Gene: ENSMUSG00000070780
AA Change: M478T

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113724
AA Change: M478T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109353
Gene: ENSMUSG00000070780
AA Change: M478T

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113726
AA Change: M478T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109355
Gene: ENSMUSG00000070780
AA Change: M478T

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167950
AA Change: M478T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128016
Gene: ENSMUSG00000070780
AA Change: M478T

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200775
AA Change: M478T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144325
Gene: ENSMUSG00000070780
AA Change: M478T

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200852
SMART Domains Protein: ENSMUSP00000144505
Gene: ENSMUSG00000070780

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201311
Predicted Effect probably benign
Transcript: ENSMUST00000201544
AA Change: M478T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144122
Gene: ENSMUSG00000070780
AA Change: M478T

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201561
Predicted Effect probably benign
Transcript: ENSMUST00000202700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202794
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit partial prenatal lethality. Surviving adults are small and display impaired cytidine to uridine RNA editing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,212,358 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Apc2 A G 10: 80,305,544 K268E probably damaging Het
Arhgef2 G C 3: 88,643,878 R765P probably benign Het
Bptf T C 11: 107,081,523 K840E probably damaging Het
Carf A G 1: 60,136,347 R245G possibly damaging Het
Cd36 A G 5: 17,785,720 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fam83f A T 15: 80,692,192 N348I possibly damaging Het
Gja8 A G 3: 96,919,152 V398A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm12789 A T 4: 101,988,329 T72S possibly damaging Het
Gm1988 A G 7: 39,170,868 noncoding transcript Het
Gm21370 A G 13: 120,026,953 V20A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd17b13 T A 5: 103,965,854 S245C probably benign Het
Htr1f T C 16: 64,925,961 K323E probably benign Het
Igkc T C 6: 70,726,458 probably benign Het
Ksr1 T C 11: 79,027,477 E535G probably damaging Het
Mlxipl A T 5: 135,132,527 E433D probably benign Het
Npc1 T C 18: 12,198,162 probably null Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr220 A G 1: 174,448,934 T104A probably benign Het
Olfr389 A G 11: 73,776,841 L162P probably damaging Het
Olfr829 T C 9: 18,857,102 I159T probably benign Het
Pcdha3 A G 18: 36,948,451 R749G probably benign Het
Ppme1 A T 7: 100,347,837 N122K possibly damaging Het
Rasal1 G A 5: 120,675,609 V657M possibly damaging Het
Rragd C T 4: 33,007,155 T161M probably damaging Het
Slurp1 T C 15: 74,726,875 H89R possibly damaging Het
Snap23 A G 2: 120,585,580 I42V probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar8a T A 10: 24,077,164 V222E probably damaging Het
Tmem171 A T 13: 98,692,588 V18D probably damaging Het
Topors T C 4: 40,260,794 D830G unknown Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Tubg1 T A 11: 101,124,538 M270K possibly damaging Het
Vmn1r188 T C 13: 22,088,602 V242A probably benign Het
Vmn1r19 T A 6: 57,404,735 I91N probably damaging Het
Vmn2r12 T A 5: 109,091,546 M384L probably benign Het
Wdr26 T C 1: 181,203,114 E205G probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp398 T A 6: 47,866,225 C272S probably damaging Het
Zfp975 A G 7: 42,662,874 V105A probably benign Het
Other mutations in Rbm47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Rbm47 APN 5 66026738 missense possibly damaging 0.75
IGL01648:Rbm47 APN 5 66024978 missense possibly damaging 0.59
IGL02323:Rbm47 APN 5 66026429 missense probably damaging 1.00
IGL02456:Rbm47 APN 5 66027021 missense probably damaging 1.00
IGL03329:Rbm47 APN 5 66026693 missense probably damaging 0.98
PIT4402001:Rbm47 UTSW 5 66027011 missense probably damaging 1.00
R0131:Rbm47 UTSW 5 66026529 missense possibly damaging 0.86
R1575:Rbm47 UTSW 5 66025015 missense probably benign 0.00
R1587:Rbm47 UTSW 5 66024991 missense probably benign 0.23
R1645:Rbm47 UTSW 5 66027138 missense probably benign 0.44
R1750:Rbm47 UTSW 5 66019310 missense possibly damaging 0.78
R4085:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4087:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4280:Rbm47 UTSW 5 66026177 missense probably damaging 1.00
R4714:Rbm47 UTSW 5 66025052 missense probably damaging 1.00
R4744:Rbm47 UTSW 5 66026693 missense probably damaging 0.98
R4807:Rbm47 UTSW 5 66019304 missense possibly damaging 0.71
R5453:Rbm47 UTSW 5 66027182 missense probably benign 0.07
R6090:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6091:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6136:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6137:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6159:Rbm47 UTSW 5 66026816 missense probably damaging 0.99
R6181:Rbm47 UTSW 5 66026490 missense possibly damaging 0.92
R6425:Rbm47 UTSW 5 66022816 missense probably damaging 1.00
R7292:Rbm47 UTSW 5 66026750 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTGAGAGAGGCTCCATAGATAAATG -3'
(R):5'- AGTGTAGGGCTGCTAACCTG -3'

Sequencing Primer
(F):5'- GGCTCCATAGATAAATGATAGCAGCC -3'
(R):5'- GGGCTGCTAACCTGGACTTTAAAAC -3'
Posted On2015-05-15