Incidental Mutation 'R4090:Zfp398'
ID317560
Institutional Source Beutler Lab
Gene Symbol Zfp398
Ensembl Gene ENSMUSG00000062519
Gene Namezinc finger protein 398
Synonyms
MMRRC Submission 040983-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4090 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47835661-47873537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47866225 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 272 (C272S)
Ref Sequence ENSEMBL: ENSMUSP00000110245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079881] [ENSMUST00000114598]
Predicted Effect probably damaging
Transcript: ENSMUST00000079881
AA Change: C404S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078806
Gene: ENSMUSG00000062519
AA Change: C404S

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:DUF3669 43 113 2.9e-10 PFAM
KRAB 143 203 1.38e-17 SMART
low complexity region 278 296 N/A INTRINSIC
ZnF_C2H2 344 365 6.31e1 SMART
ZnF_C2H2 399 421 3.58e-2 SMART
ZnF_C2H2 428 450 1.36e-2 SMART
ZnF_C2H2 456 478 1.69e-3 SMART
ZnF_C2H2 484 506 2.24e-3 SMART
ZnF_C2H2 512 534 6.78e-3 SMART
ZnF_C2H2 540 562 9.08e-4 SMART
ZnF_C2H2 568 591 5.14e-3 SMART
low complexity region 598 611 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114598
AA Change: C272S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110245
Gene: ENSMUSG00000062519
AA Change: C272S

DomainStartEndE-ValueType
KRAB 11 71 1.38e-17 SMART
low complexity region 146 164 N/A INTRINSIC
ZnF_C2H2 212 233 6.31e1 SMART
ZnF_C2H2 267 289 3.58e-2 SMART
ZnF_C2H2 296 318 1.36e-2 SMART
ZnF_C2H2 324 346 1.69e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 6.78e-3 SMART
ZnF_C2H2 408 430 9.08e-4 SMART
ZnF_C2H2 436 459 5.14e-3 SMART
low complexity region 466 479 N/A INTRINSIC
Meta Mutation Damage Score 0.528 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel family of C2H2-type zinc-finger transcription factor proteins. The encoded protein acts as a transcriptional activator. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described, but their full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,212,358 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Apc2 A G 10: 80,305,544 K268E probably damaging Het
Arhgef2 G C 3: 88,643,878 R765P probably benign Het
Bptf T C 11: 107,081,523 K840E probably damaging Het
Carf A G 1: 60,136,347 R245G possibly damaging Het
Cd36 A G 5: 17,785,720 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fam83f A T 15: 80,692,192 N348I possibly damaging Het
Gja8 A G 3: 96,919,152 V398A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm12789 A T 4: 101,988,329 T72S possibly damaging Het
Gm1988 A G 7: 39,170,868 noncoding transcript Het
Gm21370 A G 13: 120,026,953 V20A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd17b13 T A 5: 103,965,854 S245C probably benign Het
Htr1f T C 16: 64,925,961 K323E probably benign Het
Igkc T C 6: 70,726,458 probably benign Het
Ksr1 T C 11: 79,027,477 E535G probably damaging Het
Mlxipl A T 5: 135,132,527 E433D probably benign Het
Npc1 T C 18: 12,198,162 probably null Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr220 A G 1: 174,448,934 T104A probably benign Het
Olfr389 A G 11: 73,776,841 L162P probably damaging Het
Olfr829 T C 9: 18,857,102 I159T probably benign Het
Pcdha3 A G 18: 36,948,451 R749G probably benign Het
Ppme1 A T 7: 100,347,837 N122K possibly damaging Het
Rasal1 G A 5: 120,675,609 V657M possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rragd C T 4: 33,007,155 T161M probably damaging Het
Slurp1 T C 15: 74,726,875 H89R possibly damaging Het
Snap23 A G 2: 120,585,580 I42V probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar8a T A 10: 24,077,164 V222E probably damaging Het
Tmem171 A T 13: 98,692,588 V18D probably damaging Het
Topors T C 4: 40,260,794 D830G unknown Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Tubg1 T A 11: 101,124,538 M270K possibly damaging Het
Vmn1r188 T C 13: 22,088,602 V242A probably benign Het
Vmn1r19 T A 6: 57,404,735 I91N probably damaging Het
Vmn2r12 T A 5: 109,091,546 M384L probably benign Het
Wdr26 T C 1: 181,203,114 E205G probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp975 A G 7: 42,662,874 V105A probably benign Het
Other mutations in Zfp398
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Zfp398 APN 6 47865934 missense probably benign
IGL01543:Zfp398 APN 6 47866063 missense probably damaging 1.00
IGL01822:Zfp398 APN 6 47866271 missense probably damaging 1.00
IGL02118:Zfp398 APN 6 47858945 missense probably damaging 1.00
IGL02454:Zfp398 APN 6 47840367 missense possibly damaging 0.93
IGL02725:Zfp398 APN 6 47865803 missense probably benign 0.00
R0453:Zfp398 UTSW 6 47865848 missense probably benign 0.01
R0635:Zfp398 UTSW 6 47863140 missense probably damaging 1.00
R1759:Zfp398 UTSW 6 47859478 missense possibly damaging 0.92
R2366:Zfp398 UTSW 6 47863209 missense possibly damaging 0.93
R2696:Zfp398 UTSW 6 47866945 makesense probably null
R4157:Zfp398 UTSW 6 47835909 missense probably benign
R4610:Zfp398 UTSW 6 47840427 missense probably damaging 1.00
R4784:Zfp398 UTSW 6 47840252 missense probably benign
R4849:Zfp398 UTSW 6 47859512 missense possibly damaging 0.79
R5166:Zfp398 UTSW 6 47865904 missense probably benign
R5289:Zfp398 UTSW 6 47863181 missense probably benign
R5877:Zfp398 UTSW 6 47840704 intron probably benign
R6326:Zfp398 UTSW 6 47866421 missense possibly damaging 0.90
R6383:Zfp398 UTSW 6 47866595 missense probably damaging 1.00
R6825:Zfp398 UTSW 6 47866331 missense probably damaging 1.00
R6882:Zfp398 UTSW 6 47866082 missense probably damaging 0.99
R7038:Zfp398 UTSW 6 47866309 missense probably damaging 1.00
R7114:Zfp398 UTSW 6 47865976 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGTTAGGAAGTTACCCACTCC -3'
(R):5'- CACACTGTGGGCAACGAAAG -3'

Sequencing Primer
(F):5'- AGAGCAGGTGTTCTCATGCCAC -3'
(R):5'- AAGGGCCTCTCAGTAGCATG -3'
Posted On2015-05-15