Incidental Mutation 'R4092:2010315B03Rik'
ID317677
Institutional Source Beutler Lab
Gene Symbol 2010315B03Rik
Ensembl Gene ENSMUSG00000074829
Gene NameRIKEN cDNA 2010315B03 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4092 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location124291804-124312696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124293273 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 340 (H340Q)
Ref Sequence ENSEMBL: ENSMUSP00000137258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071300] [ENSMUST00000177714] [ENSMUST00000185949] [ENSMUST00000189915]
Predicted Effect probably benign
Transcript: ENSMUST00000071300
SMART Domains Protein: ENSMUSP00000071269
Gene: ENSMUSG00000074829

DomainStartEndE-ValueType
KRAB 24 86 5.28e-14 SMART
ZnF_C2H2 95 117 5.9e-3 SMART
ZnF_C2H2 123 145 1.26e-2 SMART
ZnF_C2H2 151 173 2.95e-3 SMART
ZnF_C2H2 179 201 4.24e-4 SMART
ZnF_C2H2 207 229 1.38e-3 SMART
ZnF_C2H2 235 257 3.21e-4 SMART
ZnF_C2H2 263 285 1.26e-2 SMART
ZnF_C2H2 291 312 6.08e0 SMART
ZnF_C2H2 318 340 8.6e-5 SMART
ZnF_C2H2 346 368 1.36e-2 SMART
ZnF_C2H2 374 396 8.02e-5 SMART
ZnF_C2H2 402 424 9.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177714
AA Change: H340Q

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137258
Gene: ENSMUSG00000074829
AA Change: H340Q

DomainStartEndE-ValueType
KRAB 28 90 5.28e-14 SMART
ZnF_C2H2 99 121 5.9e-3 SMART
ZnF_C2H2 127 149 1.26e-2 SMART
ZnF_C2H2 155 177 2.95e-3 SMART
ZnF_C2H2 183 205 4.24e-4 SMART
ZnF_C2H2 211 233 1.38e-3 SMART
ZnF_C2H2 239 261 3.21e-4 SMART
ZnF_C2H2 267 289 1.26e-2 SMART
ZnF_C2H2 295 316 6.08e0 SMART
ZnF_C2H2 322 344 8.6e-5 SMART
ZnF_C2H2 350 372 1.36e-2 SMART
ZnF_C2H2 378 400 8.02e-5 SMART
ZnF_C2H2 406 428 9.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185949
SMART Domains Protein: ENSMUSP00000140144
Gene: ENSMUSG00000074829

DomainStartEndE-ValueType
KRAB 29 91 2.3e-16 SMART
ZnF_C2H2 100 122 2.5e-5 SMART
ZnF_C2H2 128 150 5.3e-5 SMART
ZnF_C2H2 156 175 5.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189915
SMART Domains Protein: ENSMUSP00000140738
Gene: ENSMUSG00000074829

DomainStartEndE-ValueType
KRAB 1 63 2.3e-16 SMART
ZnF_C2H2 72 94 2.5e-5 SMART
ZnF_C2H2 100 122 5.3e-5 SMART
ZnF_C2H2 128 150 1.2e-5 SMART
Meta Mutation Damage Score 0.1344 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik G A 16: 14,049,482 R68H probably damaging Het
Adam22 A T 5: 8,095,004 I116N probably damaging Het
Adamts2 T A 11: 50,787,276 V794E probably damaging Het
Ak9 T C 10: 41,389,144 S966P probably benign Het
Alox5 G A 6: 116,412,674 probably benign Het
Brip1 C T 11: 86,148,521 D396N possibly damaging Het
Catsper3 C T 13: 55,784,671 H4Y probably benign Het
Cmtm2a T C 8: 104,292,771 Y62C probably benign Het
Crim1 T C 17: 78,350,836 C715R probably damaging Het
Dio3 A G 12: 110,279,800 D190G possibly damaging Het
Efl1 A G 7: 82,762,827 E808G probably benign Het
Fam196b G A 11: 34,401,935 probably benign Het
Fam83b T C 9: 76,491,661 D720G probably benign Het
Fbp2 C T 13: 62,840,360 V246M possibly damaging Het
Gm10197 G A 19: 53,371,765 probably benign Het
Gm6803 A T 12: 88,018,424 N116K possibly damaging Het
Icam2 C A 11: 106,380,797 M1I probably null Het
Kit T C 5: 75,610,810 I209T probably benign Het
Lcmt1 T C 7: 123,418,253 V200A probably damaging Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Mmadhc A G 2: 50,287,883 M174T probably benign Het
N4bp2 A G 5: 65,790,456 N143S probably benign Het
Ndufs1 G A 1: 63,157,246 A340V possibly damaging Het
Nid1 A G 13: 13,486,639 D708G probably damaging Het
Noc2l A C 4: 156,242,576 T295P probably damaging Het
Nutm1 T A 2: 112,249,464 N702I probably damaging Het
Obscn T A 11: 59,056,060 M4083L probably benign Het
Olfr1457 T C 19: 13,095,426 Y74C probably damaging Het
Otol1 T A 3: 70,027,785 I370N probably damaging Het
Paip1 T G 13: 119,449,913 S58A probably benign Het
Pfas T C 11: 68,993,949 T476A probably benign Het
Plppr3 G T 10: 79,867,480 R57S probably damaging Het
Ptgir T C 7: 16,907,007 S75P probably damaging Het
Raver1 A T 9: 21,081,272 L287Q probably damaging Het
Rps6ka4 C T 19: 6,832,255 probably null Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Scn11a T A 9: 119,789,970 M769L probably benign Het
Serpina16 G T 12: 103,672,577 H250Q probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc12a8 G A 16: 33,617,121 G308D probably damaging Het
Slfn5 T C 11: 82,961,067 L673P probably damaging Het
Sorcs2 T C 5: 36,025,822 K1036E possibly damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sptbn5 C A 2: 120,067,051 E550D probably damaging Het
Srgap3 G T 6: 112,723,084 P1002T probably benign Het
Tollip C T 7: 141,884,443 R181H probably damaging Het
Trmt1l T A 1: 151,455,033 S600R probably benign Het
Vps16 T A 2: 130,439,912 Y315N probably damaging Het
Vps50 A G 6: 3,551,037 E367G probably benign Het
Other mutations in 2010315B03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:2010315B03Rik APN 9 124295490 splice site probably benign
P4748:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0090:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0122:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0140:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0164:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0164:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0388:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0775:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0798:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R1467:2010315B03Rik UTSW 9 124295463 missense possibly damaging 0.91
R1569:2010315B03Rik UTSW 9 124293797 nonsense probably null
R2566:2010315B03Rik UTSW 9 124293071 missense probably damaging 0.97
R2566:2010315B03Rik UTSW 9 124293153 missense probably damaging 0.99
R3853:2010315B03Rik UTSW 9 124293346 missense probably damaging 1.00
R4109:2010315B03Rik UTSW 9 124295103 missense probably benign 0.01
R4646:2010315B03Rik UTSW 9 124293598 missense probably benign 0.00
R4648:2010315B03Rik UTSW 9 124293598 missense probably benign 0.00
R4705:2010315B03Rik UTSW 9 124294001 missense possibly damaging 0.86
R4764:2010315B03Rik UTSW 9 124293766 missense probably benign 0.01
R5110:2010315B03Rik UTSW 9 124295357 critical splice donor site probably null
R5117:2010315B03Rik UTSW 9 124293085 missense probably benign 0.00
R5162:2010315B03Rik UTSW 9 124293671 missense probably benign 0.08
R5226:2010315B03Rik UTSW 9 124294076 missense possibly damaging 0.91
R5426:2010315B03Rik UTSW 9 124294003 missense probably damaging 1.00
R6793:2010315B03Rik UTSW 9 124295422 missense possibly damaging 0.85
R6975:2010315B03Rik UTSW 9 124294057 missense probably benign 0.02
R7213:2010315B03Rik UTSW 9 124293900 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTGGACAGTACTATGTTGTGCA -3'
(R):5'- ACAAATGTGGTAAAGCCTTTGC -3'

Sequencing Primer
(F):5'- ATTCATAGGGTTTCTCTCCAGTATG -3'
(R):5'- GCTTTTCATAGTCATTTCCAAAGAC -3'
Posted On2015-05-15