Incidental Mutation 'R4093:Med27'
ID317704
Institutional Source Beutler Lab
Gene Symbol Med27
Ensembl Gene ENSMUSG00000026799
Gene Namemediator complex subunit 27
SynonymsD2Ertd434e, Crsp8, 1500015J03Rik, 2310042P07Rik
MMRRC Submission 041627-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R4093 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29346819-29524793 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 29377908 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028139] [ENSMUST00000113830] [ENSMUST00000159034] [ENSMUST00000159280] [ENSMUST00000162597] [ENSMUST00000162623]
Predicted Effect probably benign
Transcript: ENSMUST00000028139
SMART Domains Protein: ENSMUSP00000028139
Gene: ENSMUSG00000026799

DomainStartEndE-ValueType
Pfam:Med27 228 310 7.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153600
Predicted Effect probably benign
Transcript: ENSMUST00000159034
Predicted Effect probably benign
Transcript: ENSMUST00000159280
SMART Domains Protein: ENSMUSP00000125390
Gene: ENSMUSG00000026799

DomainStartEndE-ValueType
Pfam:Med27 85 171 1.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162597
Predicted Effect unknown
Transcript: ENSMUST00000162603
AA Change: C23Y
Predicted Effect probably benign
Transcript: ENSMUST00000162623
Meta Mutation Damage Score 0.0536 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,043,996 M2173V probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Angpt1 T C 15: 42,523,545 T138A probably damaging Het
Atp2c2 G A 8: 119,749,871 probably null Het
C330027C09Rik T C 16: 49,000,976 probably benign Het
Cadm2 A G 16: 66,784,788 V210A possibly damaging Het
Cfap70 A T 14: 20,409,113 D671E probably damaging Het
Chd2 C T 7: 73,501,016 E322K possibly damaging Het
Chrnd C T 1: 87,191,007 Q29* probably null Het
Cym A G 3: 107,214,266 S237P probably benign Het
D030068K23Rik A G 8: 109,251,459 noncoding transcript Het
Gsdma2 T A 11: 98,650,851 S135T probably benign Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hoxb3 C A 11: 96,346,100 H335N probably damaging Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Ighv1-19 G A 12: 114,708,730 T90I probably damaging Het
Kansl3 C A 1: 36,344,954 S729I probably damaging Het
Kcnab1 T C 3: 65,299,614 I137T possibly damaging Het
Kcnt1 A T 2: 25,877,915 E12V probably damaging Het
Klk15 A T 7: 43,938,780 S171C possibly damaging Het
Lcn2 A T 2: 32,387,716 M1K probably null Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp8 T A 4: 107,843,271 C135* probably null Het
Lrrc31 C A 3: 30,695,522 S54I probably damaging Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Mical1 T C 10: 41,486,937 probably benign Het
Myt1 A T 2: 181,811,398 M799L probably damaging Het
Nlrc4 T C 17: 74,445,958 M477V probably benign Het
Npy4r T C 14: 34,147,141 I63M probably benign Het
Olfr224 A T 11: 58,566,829 I172N probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr672 C T 7: 104,996,635 G90S probably benign Het
Olfr904 T A 9: 38,464,083 L14Q probably null Het
Piezo1 A C 8: 122,501,160 probably null Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Proser1 T C 3: 53,479,712 probably null Het
Psme2 A T 14: 55,588,277 N143K probably benign Het
Pygo2 C A 3: 89,433,264 P323Q probably damaging Het
Rab11b T C 17: 33,749,789 T77A possibly damaging Het
Recql5 A G 11: 115,904,888 S190P probably benign Het
Serpina12 A G 12: 104,037,924 F150L probably damaging Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a2 C T 17: 12,612,394 T357M probably damaging Het
Spag6l A C 16: 16,829,024 N39K probably benign Het
Srl A G 16: 4,497,452 S109P possibly damaging Het
Tagap A T 17: 7,929,423 H152L probably damaging Het
Tbx3 T A 5: 119,680,748 S463T probably benign Het
Tcaf2 A G 6: 42,642,838 L85P probably damaging Het
Tenm4 A T 7: 96,895,772 S2332C probably damaging Het
Trim60 A T 8: 65,001,378 M73K probably benign Het
Trpc1 T C 9: 95,706,865 T769A probably benign Het
Tubgcp4 T A 2: 121,195,477 L601Q probably benign Het
Unc5d T C 8: 28,844,837 Y154C possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Vmn1r57 G T 7: 5,220,857 S127I possibly damaging Het
Vmn1r62 T A 7: 5,675,944 M208K probably damaging Het
Vmn2r110 T C 17: 20,583,380 D311G possibly damaging Het
Vmn2r48 C A 7: 9,942,258 S432I probably benign Het
Vmn2r48 T A 7: 9,942,259 S432C probably damaging Het
Vmn2r71 T C 7: 85,621,234 V536A probably benign Het
Vstm2a A G 11: 16,259,884 T37A probably damaging Het
Wfs1 T C 5: 36,967,465 H694R probably damaging Het
Zdbf2 T C 1: 63,309,781 S2440P possibly damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Other mutations in Med27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Med27 APN 2 29413482 missense probably damaging 1.00
R0427:Med27 UTSW 2 29500271 missense probably damaging 1.00
R1769:Med27 UTSW 2 29500295 missense probably damaging 0.99
R2126:Med27 UTSW 2 29524430 nonsense probably null
R3196:Med27 UTSW 2 29346870 missense possibly damaging 0.86
R4498:Med27 UTSW 2 29471342 missense probably damaging 0.99
R4599:Med27 UTSW 2 29524458 missense probably damaging 1.00
R4722:Med27 UTSW 2 29524435 missense probably damaging 0.98
R4771:Med27 UTSW 2 29413503 missense probably damaging 1.00
R4828:Med27 UTSW 2 29377938 unclassified probably benign
R5870:Med27 UTSW 2 29389811 critical splice acceptor site probably null
R6061:Med27 UTSW 2 29509441 missense probably damaging 0.99
R6159:Med27 UTSW 2 29524364 splice site probably null
R7028:Med27 UTSW 2 29509434 nonsense probably null
R7319:Med27 UTSW 2 29413478 missense possibly damaging 0.53
R7387:Med27 UTSW 2 29413407 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTCCTTCAGGTGGAGCAAG -3'
(R):5'- TCTGCAGACTGTGGGAAAATC -3'

Sequencing Primer
(F):5'- AAGGCACCAGGGTCATCTTG -3'
(R):5'- TGCCATTCCGAGATGAGATC -3'
Posted On2015-05-15