Incidental Mutation 'R4093:Ppp1r12c'
ID317724
Institutional Source Beutler Lab
Gene Symbol Ppp1r12c
Ensembl Gene ENSMUSG00000019254
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12C
Synonyms2410197A17Rik, Mbs85
MMRRC Submission 041627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4093 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4481520-4501680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4483367 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 601 (E601G)
Ref Sequence ENSEMBL: ENSMUSP00000013886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013886] [ENSMUST00000086372] [ENSMUST00000124248] [ENSMUST00000163137] [ENSMUST00000163893] [ENSMUST00000164987] [ENSMUST00000171445]
Predicted Effect probably damaging
Transcript: ENSMUST00000013886
AA Change: E601G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000013886
Gene: ENSMUSG00000019254
AA Change: E601G

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 74 97 N/A INTRINSIC
ANK 104 133 3.71e-4 SMART
ANK 137 166 3.43e-8 SMART
low complexity region 205 210 N/A INTRINSIC
ANK 230 259 7.95e-4 SMART
ANK 263 292 2.41e-3 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 401 413 N/A INTRINSIC
internal_repeat_2 450 508 2.86e-5 PROSPERO
internal_repeat_2 545 599 2.86e-5 PROSPERO
low complexity region 631 649 N/A INTRINSIC
Pfam:PRKG1_interact 682 782 9.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086372
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124248
AA Change: E522G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120029
Gene: ENSMUSG00000019254
AA Change: E522G

DomainStartEndE-ValueType
ANK 25 54 3.71e-4 SMART
ANK 58 87 3.43e-8 SMART
low complexity region 126 131 N/A INTRINSIC
ANK 151 180 7.95e-4 SMART
ANK 184 213 2.41e-3 SMART
low complexity region 290 306 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:2KJY|A 445 498 3e-11 PDB
low complexity region 553 571 N/A INTRINSIC
coiled coil region 604 704 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154710
Predicted Effect probably benign
Transcript: ENSMUST00000163137
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163893
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164987
SMART Domains Protein: ENSMUSP00000130665
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
low complexity region 15 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171445
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a subunit of myosin phosphatase. The encoded protein regulates the catalytic activity of protein phosphatase 1 delta and assembly of the actin cytoskeleton. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,043,996 M2173V probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Angpt1 T C 15: 42,523,545 T138A probably damaging Het
Atp2c2 G A 8: 119,749,871 probably null Het
C330027C09Rik T C 16: 49,000,976 probably benign Het
Cadm2 A G 16: 66,784,788 V210A possibly damaging Het
Cfap70 A T 14: 20,409,113 D671E probably damaging Het
Chd2 C T 7: 73,501,016 E322K possibly damaging Het
Chrnd C T 1: 87,191,007 Q29* probably null Het
Cym A G 3: 107,214,266 S237P probably benign Het
D030068K23Rik A G 8: 109,251,459 noncoding transcript Het
Gsdma2 T A 11: 98,650,851 S135T probably benign Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hoxb3 C A 11: 96,346,100 H335N probably damaging Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Ighv1-19 G A 12: 114,708,730 T90I probably damaging Het
Kansl3 C A 1: 36,344,954 S729I probably damaging Het
Kcnab1 T C 3: 65,299,614 I137T possibly damaging Het
Kcnt1 A T 2: 25,877,915 E12V probably damaging Het
Klk15 A T 7: 43,938,780 S171C possibly damaging Het
Lcn2 A T 2: 32,387,716 M1K probably null Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp8 T A 4: 107,843,271 C135* probably null Het
Lrrc31 C A 3: 30,695,522 S54I probably damaging Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Med27 G A 2: 29,377,908 probably benign Het
Mical1 T C 10: 41,486,937 probably benign Het
Myt1 A T 2: 181,811,398 M799L probably damaging Het
Nlrc4 T C 17: 74,445,958 M477V probably benign Het
Npy4r T C 14: 34,147,141 I63M probably benign Het
Olfr224 A T 11: 58,566,829 I172N probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr672 C T 7: 104,996,635 G90S probably benign Het
Olfr904 T A 9: 38,464,083 L14Q probably null Het
Piezo1 A C 8: 122,501,160 probably null Het
Proser1 T C 3: 53,479,712 probably null Het
Psme2 A T 14: 55,588,277 N143K probably benign Het
Pygo2 C A 3: 89,433,264 P323Q probably damaging Het
Rab11b T C 17: 33,749,789 T77A possibly damaging Het
Recql5 A G 11: 115,904,888 S190P probably benign Het
Serpina12 A G 12: 104,037,924 F150L probably damaging Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a2 C T 17: 12,612,394 T357M probably damaging Het
Spag6l A C 16: 16,829,024 N39K probably benign Het
Srl A G 16: 4,497,452 S109P possibly damaging Het
Tagap A T 17: 7,929,423 H152L probably damaging Het
Tbx3 T A 5: 119,680,748 S463T probably benign Het
Tcaf2 A G 6: 42,642,838 L85P probably damaging Het
Tenm4 A T 7: 96,895,772 S2332C probably damaging Het
Trim60 A T 8: 65,001,378 M73K probably benign Het
Trpc1 T C 9: 95,706,865 T769A probably benign Het
Tubgcp4 T A 2: 121,195,477 L601Q probably benign Het
Unc5d T C 8: 28,844,837 Y154C possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Vmn1r57 G T 7: 5,220,857 S127I possibly damaging Het
Vmn1r62 T A 7: 5,675,944 M208K probably damaging Het
Vmn2r110 T C 17: 20,583,380 D311G possibly damaging Het
Vmn2r48 C A 7: 9,942,258 S432I probably benign Het
Vmn2r48 T A 7: 9,942,259 S432C probably damaging Het
Vmn2r71 T C 7: 85,621,234 V536A probably benign Het
Vstm2a A G 11: 16,259,884 T37A probably damaging Het
Wfs1 T C 5: 36,967,465 H694R probably damaging Het
Zdbf2 T C 1: 63,309,781 S2440P possibly damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Other mutations in Ppp1r12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Ppp1r12c APN 7 4497345 splice site probably benign
IGL01419:Ppp1r12c APN 7 4486352 splice site probably null
IGL02126:Ppp1r12c APN 7 4489859 missense probably benign 0.43
IGL03388:Ppp1r12c APN 7 4482070 unclassified probably benign
PIT4418001:Ppp1r12c UTSW 7 4501267 missense probably null 0.09
R0523:Ppp1r12c UTSW 7 4489772 missense probably damaging 1.00
R0815:Ppp1r12c UTSW 7 4486366 missense probably damaging 1.00
R0863:Ppp1r12c UTSW 7 4486366 missense probably damaging 1.00
R1413:Ppp1r12c UTSW 7 4484444 splice site probably null
R1522:Ppp1r12c UTSW 7 4497425 missense probably damaging 1.00
R1835:Ppp1r12c UTSW 7 4483651 missense probably damaging 1.00
R2004:Ppp1r12c UTSW 7 4482975 nonsense probably null
R2170:Ppp1r12c UTSW 7 4482806 missense possibly damaging 0.76
R3787:Ppp1r12c UTSW 7 4486584 missense probably damaging 1.00
R3833:Ppp1r12c UTSW 7 4482786 unclassified probably benign
R4095:Ppp1r12c UTSW 7 4483367 missense probably damaging 0.99
R4108:Ppp1r12c UTSW 7 4486566 missense probably damaging 1.00
R5177:Ppp1r12c UTSW 7 4484496 nonsense probably null
R5319:Ppp1r12c UTSW 7 4483984 missense probably benign 0.01
R5561:Ppp1r12c UTSW 7 4486356 critical splice donor site probably null
R5739:Ppp1r12c UTSW 7 4497282 missense probably damaging 1.00
R5837:Ppp1r12c UTSW 7 4497404 intron probably benign
R6531:Ppp1r12c UTSW 7 4482789 critical splice donor site probably null
R7207:Ppp1r12c UTSW 7 4489868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCAGCTTTTCGATGCTC -3'
(R):5'- ACTCTAACAGACTTGAAGGAAGC -3'

Sequencing Primer
(F):5'- CGCCTCTGCTGGGGAATTG -3'
(R):5'- CTTGAAGGAAGCAGAAAAGGTGGC -3'
Posted On2015-05-15