Incidental Mutation 'R4093:Atp2c2'
ID317741
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene NameATPase, Ca++ transporting, type 2C, member 2
Synonyms
MMRRC Submission 041627-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4093 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location119700009-119757717 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 119749871 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171]
Predicted Effect probably null
Transcript: ENSMUST00000095171
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Meta Mutation Damage Score 0.456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (69/75)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,043,996 M2173V probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Angpt1 T C 15: 42,523,545 T138A probably damaging Het
C330027C09Rik T C 16: 49,000,976 probably benign Het
Cadm2 A G 16: 66,784,788 V210A possibly damaging Het
Cfap70 A T 14: 20,409,113 D671E probably damaging Het
Chd2 C T 7: 73,501,016 E322K possibly damaging Het
Chrnd C T 1: 87,191,007 Q29* probably null Het
Cym A G 3: 107,214,266 S237P probably benign Het
D030068K23Rik A G 8: 109,251,459 noncoding transcript Het
Gsdma2 T A 11: 98,650,851 S135T probably benign Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hoxb3 C A 11: 96,346,100 H335N probably damaging Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Ighv1-19 G A 12: 114,708,730 T90I probably damaging Het
Kansl3 C A 1: 36,344,954 S729I probably damaging Het
Kcnab1 T C 3: 65,299,614 I137T possibly damaging Het
Kcnt1 A T 2: 25,877,915 E12V probably damaging Het
Klk15 A T 7: 43,938,780 S171C possibly damaging Het
Lcn2 A T 2: 32,387,716 M1K probably null Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp8 T A 4: 107,843,271 C135* probably null Het
Lrrc31 C A 3: 30,695,522 S54I probably damaging Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Med27 G A 2: 29,377,908 probably benign Het
Mical1 T C 10: 41,486,937 probably benign Het
Myt1 A T 2: 181,811,398 M799L probably damaging Het
Nlrc4 T C 17: 74,445,958 M477V probably benign Het
Npy4r T C 14: 34,147,141 I63M probably benign Het
Olfr224 A T 11: 58,566,829 I172N probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr672 C T 7: 104,996,635 G90S probably benign Het
Olfr904 T A 9: 38,464,083 L14Q probably null Het
Piezo1 A C 8: 122,501,160 probably null Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Proser1 T C 3: 53,479,712 probably null Het
Psme2 A T 14: 55,588,277 N143K probably benign Het
Pygo2 C A 3: 89,433,264 P323Q probably damaging Het
Rab11b T C 17: 33,749,789 T77A possibly damaging Het
Recql5 A G 11: 115,904,888 S190P probably benign Het
Serpina12 A G 12: 104,037,924 F150L probably damaging Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a2 C T 17: 12,612,394 T357M probably damaging Het
Spag6l A C 16: 16,829,024 N39K probably benign Het
Srl A G 16: 4,497,452 S109P possibly damaging Het
Tagap A T 17: 7,929,423 H152L probably damaging Het
Tbx3 T A 5: 119,680,748 S463T probably benign Het
Tcaf2 A G 6: 42,642,838 L85P probably damaging Het
Tenm4 A T 7: 96,895,772 S2332C probably damaging Het
Trim60 A T 8: 65,001,378 M73K probably benign Het
Trpc1 T C 9: 95,706,865 T769A probably benign Het
Tubgcp4 T A 2: 121,195,477 L601Q probably benign Het
Unc5d T C 8: 28,844,837 Y154C possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Vmn1r57 G T 7: 5,220,857 S127I possibly damaging Het
Vmn1r62 T A 7: 5,675,944 M208K probably damaging Het
Vmn2r110 T C 17: 20,583,380 D311G possibly damaging Het
Vmn2r48 C A 7: 9,942,258 S432I probably benign Het
Vmn2r48 T A 7: 9,942,259 S432C probably damaging Het
Vmn2r71 T C 7: 85,621,234 V536A probably benign Het
Vstm2a A G 11: 16,259,884 T37A probably damaging Het
Wfs1 T C 5: 36,967,465 H694R probably damaging Het
Zdbf2 T C 1: 63,309,781 S2440P possibly damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 119745590 missense probably benign
IGL01624:Atp2c2 APN 8 119757450 missense probably benign 0.00
IGL02133:Atp2c2 APN 8 119754335 missense probably benign 0.00
IGL02221:Atp2c2 APN 8 119744334 missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 119730274 missense probably benign
IGL02657:Atp2c2 APN 8 119753032 missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 119749120 missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 119742675 missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 119749062 missense probably benign 0.15
R0372:Atp2c2 UTSW 8 119757441 missense probably benign
R0502:Atp2c2 UTSW 8 119734577 missense probably null 0.99
R0503:Atp2c2 UTSW 8 119734577 missense probably null 0.99
R0584:Atp2c2 UTSW 8 119738418 missense probably benign 0.01
R1225:Atp2c2 UTSW 8 119735245 missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 119752987 missense probably benign 0.00
R1620:Atp2c2 UTSW 8 119749126 missense probably benign
R1638:Atp2c2 UTSW 8 119756003 missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 119725094 missense probably benign 0.02
R1746:Atp2c2 UTSW 8 119734443 unclassified probably benign
R1907:Atp2c2 UTSW 8 119749876 splice site probably benign
R2104:Atp2c2 UTSW 8 119749845 missense probably benign
R2151:Atp2c2 UTSW 8 119756102 missense probably benign
R2152:Atp2c2 UTSW 8 119756102 missense probably benign
R2154:Atp2c2 UTSW 8 119756102 missense probably benign
R2207:Atp2c2 UTSW 8 119748309 missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 119735296 missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 119721276 missense probably damaging 1.00
R4782:Atp2c2 UTSW 8 119749152 missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 119747687 missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 119754263 missense probably benign 0.00
R5485:Atp2c2 UTSW 8 119753062 critical splice donor site probably null
R5978:Atp2c2 UTSW 8 119749875 splice site probably null
R6377:Atp2c2 UTSW 8 119726354 missense probably benign 0.10
R6613:Atp2c2 UTSW 8 119756021 missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 119753017 missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 119734415 missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 119730267 nonsense probably null
R7220:Atp2c2 UTSW 8 119745561 missense probably benign 0.00
R7238:Atp2c2 UTSW 8 119742421 missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 119730252 missense probably benign 0.02
R7438:Atp2c2 UTSW 8 119748197 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTTGTGTCAAATGCCGGG -3'
(R):5'- CAATCCTGTTGCTTGGCCAG -3'

Sequencing Primer
(F):5'- GGAGGGTCAGGGCCACC -3'
(R):5'- TTGGCCAGCTGAGAGCCTG -3'
Posted On2015-05-15