Incidental Mutation 'R4094:St8sia4'
ID317772
Institutional Source Beutler Lab
Gene Symbol St8sia4
Ensembl Gene ENSMUSG00000040710
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
SynonymsST8SiaIV, PST, Siat8d, PST-1
MMRRC Submission 041628-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4094 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location95587682-95667571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95627686 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 206 (S206R)
Ref Sequence ENSEMBL: ENSMUSP00000140534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043336] [ENSMUST00000189556]
Predicted Effect probably benign
Transcript: ENSMUST00000043336
AA Change: S206R

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000043477
Gene: ENSMUSG00000040710
AA Change: S206R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_transf_29 94 354 2.2e-73 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189556
AA Change: S206R

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140534
Gene: ENSMUSG00000040710
AA Change: S206R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Glyco_transf_29 90 266 2.2e-42 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). The encoded protein, which is a member of glycosyltransferase family 29, is a type II membrane protein that may be present in the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null adult mice exhibit impaired long term potentiation and impaired long term depression in hippocampal CA1 synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,180,366 C1500R probably damaging Het
Amz1 A T 5: 140,752,166 M93L probably damaging Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Bsn A C 9: 108,113,870 V1561G probably damaging Het
Cadm2 A T 16: 66,882,797 N49K probably damaging Het
Cct8 T G 16: 87,487,628 I283L possibly damaging Het
Cdc25b A G 2: 131,189,117 M121V probably benign Het
Cpne4 A G 9: 104,686,535 D37G probably damaging Het
Cym A G 3: 107,214,266 S237P probably benign Het
Dhx35 T A 2: 158,842,356 I517N probably damaging Het
Ehf T C 2: 103,290,750 probably benign Het
Erp29 A G 5: 121,452,282 probably benign Het
Fam160a2 T C 7: 105,388,218 D386G probably damaging Het
Fgd6 C A 10: 94,043,434 P50Q probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Frmd4a A G 2: 4,611,032 Y1031C probably damaging Het
Gna13 T A 11: 109,396,416 I355N probably damaging Het
Hgs T A 11: 120,469,033 L21* probably null Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Itga2 T C 13: 114,870,625 D389G probably benign Het
Kdm1b T C 13: 47,063,020 C289R probably damaging Het
Kdm4c T A 4: 74,311,678 D237E probably benign Het
Lilr4b A T 10: 51,481,410 E114V probably damaging Het
Loxl1 G A 9: 58,312,456 T144I probably damaging Het
Macf1 C T 4: 123,459,269 R1784Q probably benign Het
Maml2 G A 9: 13,620,153 S221N probably benign Het
Map3k1 A G 13: 111,756,162 M853T possibly damaging Het
Micu3 T G 8: 40,335,888 S147A probably null Het
Nccrp1 T C 7: 28,544,226 Y261C possibly damaging Het
Olfr1030 A G 2: 85,984,218 Y126C probably damaging Het
Olfr1049 T C 2: 86,255,330 D121G probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr611 T A 7: 103,518,037 I116F possibly damaging Het
Pclo C A 5: 14,855,645 T4963N unknown Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Plcg1 A G 2: 160,747,841 E95G probably damaging Het
Ppargc1a T C 5: 51,490,064 N276S possibly damaging Het
Prr12 A G 7: 45,047,947 L848P unknown Het
Ptcd2 A G 13: 99,332,449 I202T probably damaging Het
Rab27a A C 9: 73,075,544 I44L probably damaging Het
Rbfox2 A T 15: 77,132,725 S82T probably damaging Het
Rsbn1 T A 3: 103,928,658 F337L probably damaging Het
Samd8 T C 14: 21,793,045 I414T probably damaging Het
Sema3e A G 5: 14,233,690 I478V probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc2a3 A T 6: 122,735,568 I239N probably benign Het
Spc25 G A 2: 69,202,631 S50L probably damaging Het
Syngr3 G A 17: 24,689,843 probably benign Het
Tigd4 A G 3: 84,594,640 D288G probably damaging Het
Trim34b A G 7: 104,334,588 M251V probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ttn T C 2: 76,900,516 probably benign Het
Vmp1 A G 11: 86,643,580 I167T probably benign Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Zscan4f A T 7: 11,401,258 N197I probably damaging Het
Other mutations in St8sia4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:St8sia4 APN 1 95653757 missense probably benign 0.19
IGL02109:St8sia4 APN 1 95660892 missense possibly damaging 0.68
IGL03117:St8sia4 APN 1 95591783 missense probably benign 0.12
IGL03280:St8sia4 APN 1 95653774 splice site probably benign
IGL03328:St8sia4 APN 1 95660870 missense probably benign 0.01
R0336:St8sia4 UTSW 1 95653558 missense probably benign 0.36
R0433:St8sia4 UTSW 1 95591704 missense probably damaging 0.97
R1217:St8sia4 UTSW 1 95653739 missense probably damaging 1.00
R1721:St8sia4 UTSW 1 95653669 missense probably damaging 0.99
R1752:St8sia4 UTSW 1 95591812 missense probably benign 0.32
R1891:St8sia4 UTSW 1 95591708 missense possibly damaging 0.93
R1909:St8sia4 UTSW 1 95627573 missense probably damaging 1.00
R2098:St8sia4 UTSW 1 95653528 missense probably damaging 1.00
R2322:St8sia4 UTSW 1 95653738 missense probably damaging 1.00
R4365:St8sia4 UTSW 1 95591792 missense possibly damaging 0.89
R4852:St8sia4 UTSW 1 95660898 missense probably damaging 1.00
R4988:St8sia4 UTSW 1 95591797 missense possibly damaging 0.95
R5074:St8sia4 UTSW 1 95667185 missense probably benign 0.29
R5220:St8sia4 UTSW 1 95627735 missense probably damaging 0.97
R5611:St8sia4 UTSW 1 95627684 missense probably damaging 0.96
R5970:St8sia4 UTSW 1 95653582 missense probably damaging 1.00
R6027:St8sia4 UTSW 1 95653674 missense probably damaging 1.00
R6683:St8sia4 UTSW 1 95653699 missense probably damaging 1.00
X0063:St8sia4 UTSW 1 95591923 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTGTGTCAAGGACAGACTGGTC -3'
(R):5'- CATGAGCACGCTGTTTTATGG -3'

Sequencing Primer
(F):5'- TACCCTCTGACTGCATGAATAAGTC -3'
(R):5'- CACGCTGTTTTATGGGTGAATTTTTC -3'
Posted On2015-05-15