Incidental Mutation 'R4094:Ehf'
ID317778
Institutional Source Beutler Lab
Gene Symbol Ehf
Ensembl Gene ENSMUSG00000012350
Gene Nameets homologous factor
Synonyms9030625L19Rik
MMRRC Submission 041628-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.566) question?
Stock #R4094 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location103263433-103303278 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 103290750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090475] [ENSMUST00000111176] [ENSMUST00000125788] [ENSMUST00000140503] [ENSMUST00000151265]
Predicted Effect probably benign
Transcript: ENSMUST00000090475
SMART Domains Protein: ENSMUSP00000087961
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111176
SMART Domains Protein: ENSMUSP00000106807
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 183 270 1.84e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125788
SMART Domains Protein: ENSMUSP00000121103
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 42 126 1.39e-35 SMART
PDB:3JTG|A 215 242 1e-8 PDB
Blast:ETS 217 242 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128546
Predicted Effect unknown
Transcript: ENSMUST00000140503
AA Change: I25M
SMART Domains Protein: ENSMUSP00000114979
Gene: ENSMUSG00000012350
AA Change: I25M

DomainStartEndE-ValueType
SAM_PNT 70 154 1.39e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151265
SMART Domains Protein: ENSMUSP00000118275
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,180,366 C1500R probably damaging Het
Amz1 A T 5: 140,752,166 M93L probably damaging Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Bsn A C 9: 108,113,870 V1561G probably damaging Het
Cadm2 A T 16: 66,882,797 N49K probably damaging Het
Cct8 T G 16: 87,487,628 I283L possibly damaging Het
Cdc25b A G 2: 131,189,117 M121V probably benign Het
Cpne4 A G 9: 104,686,535 D37G probably damaging Het
Cym A G 3: 107,214,266 S237P probably benign Het
Dhx35 T A 2: 158,842,356 I517N probably damaging Het
Erp29 A G 5: 121,452,282 probably benign Het
Fam160a2 T C 7: 105,388,218 D386G probably damaging Het
Fgd6 C A 10: 94,043,434 P50Q probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Frmd4a A G 2: 4,611,032 Y1031C probably damaging Het
Gna13 T A 11: 109,396,416 I355N probably damaging Het
Hgs T A 11: 120,469,033 L21* probably null Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Itga2 T C 13: 114,870,625 D389G probably benign Het
Kdm1b T C 13: 47,063,020 C289R probably damaging Het
Kdm4c T A 4: 74,311,678 D237E probably benign Het
Lilr4b A T 10: 51,481,410 E114V probably damaging Het
Loxl1 G A 9: 58,312,456 T144I probably damaging Het
Macf1 C T 4: 123,459,269 R1784Q probably benign Het
Maml2 G A 9: 13,620,153 S221N probably benign Het
Map3k1 A G 13: 111,756,162 M853T possibly damaging Het
Micu3 T G 8: 40,335,888 S147A probably null Het
Nccrp1 T C 7: 28,544,226 Y261C possibly damaging Het
Olfr1030 A G 2: 85,984,218 Y126C probably damaging Het
Olfr1049 T C 2: 86,255,330 D121G probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr611 T A 7: 103,518,037 I116F possibly damaging Het
Pclo C A 5: 14,855,645 T4963N unknown Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Plcg1 A G 2: 160,747,841 E95G probably damaging Het
Ppargc1a T C 5: 51,490,064 N276S possibly damaging Het
Prr12 A G 7: 45,047,947 L848P unknown Het
Ptcd2 A G 13: 99,332,449 I202T probably damaging Het
Rab27a A C 9: 73,075,544 I44L probably damaging Het
Rbfox2 A T 15: 77,132,725 S82T probably damaging Het
Rsbn1 T A 3: 103,928,658 F337L probably damaging Het
Samd8 T C 14: 21,793,045 I414T probably damaging Het
Sema3e A G 5: 14,233,690 I478V probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc2a3 A T 6: 122,735,568 I239N probably benign Het
Spc25 G A 2: 69,202,631 S50L probably damaging Het
St8sia4 A T 1: 95,627,686 S206R possibly damaging Het
Syngr3 G A 17: 24,689,843 probably benign Het
Tigd4 A G 3: 84,594,640 D288G probably damaging Het
Trim34b A G 7: 104,334,588 M251V probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ttn T C 2: 76,900,516 probably benign Het
Vmp1 A G 11: 86,643,580 I167T probably benign Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Zscan4f A T 7: 11,401,258 N197I probably damaging Het
Other mutations in Ehf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Ehf APN 2 103266840 unclassified probably null
IGL01296:Ehf APN 2 103268155 splice site probably null
IGL02095:Ehf APN 2 103266991 missense probably damaging 1.00
R0399:Ehf UTSW 2 103266870 missense probably damaging 1.00
R1116:Ehf UTSW 2 103267009 missense probably damaging 1.00
R1728:Ehf UTSW 2 103273906 missense possibly damaging 0.51
R1729:Ehf UTSW 2 103273906 missense possibly damaging 0.51
R2240:Ehf UTSW 2 103274075 missense probably benign
R2287:Ehf UTSW 2 103267124 missense possibly damaging 0.89
R2397:Ehf UTSW 2 103276819 missense probably damaging 0.99
R4687:Ehf UTSW 2 103267126 missense probably damaging 1.00
R4930:Ehf UTSW 2 103266857 missense probably damaging 1.00
R5695:Ehf UTSW 2 103266779 missense probably damaging 1.00
R5925:Ehf UTSW 2 103266993 unclassified probably null
R6656:Ehf UTSW 2 103283583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCACTGAACTGCCTTGTATC -3'
(R):5'- CAGTTCTGAGGCAGTGTGAG -3'

Sequencing Primer
(F):5'- TGAACTGCCTTGTATCTTTATTAAGC -3'
(R):5'- CTGAGGCAGTGTGAGGAGTG -3'
Posted On2015-05-15