Incidental Mutation 'R0393:Thbs1'
ID31778
Institutional Source Beutler Lab
Gene Symbol Thbs1
Ensembl Gene ENSMUSG00000040152
Gene Namethrombospondin 1
SynonymsTSP-1, TSP1, tbsp1, Thbs-1
MMRRC Submission 038599-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R0393 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118111876-118127133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118112991 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 30 (V30E)
Ref Sequence ENSEMBL: ENSMUSP00000044903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039559
AA Change: V30E

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152
AA Change: V30E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TSPN 24 221 2.68e-60 SMART
low complexity region 237 249 N/A INTRINSIC
coiled coil region 292 315 N/A INTRINSIC
VWC 319 373 3.6e-20 SMART
TSP1 383 430 4.21e-12 SMART
TSP1 439 491 3.04e-18 SMART
TSP1 496 548 8.6e-18 SMART
EGF 551 588 3.88e-3 SMART
EGF 592 646 1.69e1 SMART
EGF 650 691 7.13e-2 SMART
Pfam:TSP_3 728 763 5.8e-12 PFAM
Pfam:TSP_3 763 786 2.1e-5 PFAM
Pfam:TSP_3 787 822 3.3e-13 PFAM
Pfam:TSP_3 822 845 1.1e-6 PFAM
Pfam:TSP_3 846 883 2e-15 PFAM
Pfam:TSP_3 884 919 8.3e-13 PFAM
Pfam:TSP_3 920 954 4.9e-10 PFAM
Pfam:TSP_C 973 1170 1.4e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148587
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,645,878 probably benign Het
Akr1b7 T G 6: 34,415,400 Y49* probably null Het
Ankrd10 G T 8: 11,635,482 R46S possibly damaging Het
Atp13a5 A G 16: 29,266,929 probably benign Het
Baz1a A G 12: 54,918,436 probably null Het
Bicd2 C T 13: 49,379,870 T644M probably damaging Het
Ccr9 A T 9: 123,779,970 H239L probably benign Het
Cd180 A T 13: 102,705,900 N485Y probably damaging Het
Ces1d T A 8: 93,192,772 S131C probably damaging Het
Cnpy2 T A 10: 128,326,207 S116R probably benign Het
Crym T C 7: 120,189,749 K285R probably benign Het
Cyp2a4 A T 7: 26,312,868 I359F possibly damaging Het
Cyp2b10 T A 7: 25,914,934 probably benign Het
Dcpp3 A T 17: 23,917,951 probably benign Het
Dnah8 T A 17: 30,708,390 I1340K probably benign Het
Fbln1 T C 15: 85,227,076 C144R probably damaging Het
Gm1553 T C 10: 82,492,176 R66G unknown Het
Il10rb G A 16: 91,412,010 V103I probably benign Het
Irak1bp1 T A 9: 82,846,561 W182R probably benign Het
Kcna3 T C 3: 107,036,999 S193P probably damaging Het
Kif14 C T 1: 136,482,418 H628Y probably damaging Het
Krt31 A G 11: 100,050,253 L77P probably damaging Het
Krt36 C T 11: 100,104,114 A211T possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lmo7 A G 14: 101,900,456 T743A probably benign Het
Lyst C T 13: 13,647,079 T1346M probably benign Het
Mapkbp1 T A 2: 120,012,903 probably null Het
Mif T C 10: 75,859,804 D55G probably benign Het
Mlh3 G T 12: 85,267,587 C608* probably null Het
Mlip A T 9: 77,239,577 C85S probably benign Het
Mug1 T C 6: 121,849,850 S211P possibly damaging Het
Mybl2 T A 2: 163,061,608 probably benign Het
Myh8 C T 11: 67,306,017 probably benign Het
Nanos1 A G 19: 60,756,930 Y222C probably damaging Het
Olfr1113 A T 2: 87,213,693 Y267F probably benign Het
Olfr1155 T C 2: 87,943,565 D21G possibly damaging Het
Olfr138 G T 17: 38,274,883 M37I probably benign Het
Papolb A G 5: 142,529,456 V144A probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Plod1 A T 4: 147,918,841 L95Q probably null Het
Ppp1r13b C A 12: 111,835,688 M290I probably benign Het
Ralb G C 1: 119,478,126 probably null Het
Slc4a8 T A 15: 100,774,638 D18E probably damaging Het
Speg A C 1: 75,423,924 H2576P possibly damaging Het
Spock1 T C 13: 57,440,536 D241G probably damaging Het
Tcam1 T A 11: 106,284,214 V165E probably benign Het
Tll2 A G 19: 41,088,826 Y834H possibly damaging Het
Tmem5 T C 10: 122,095,936 probably benign Het
Trpm6 G A 19: 18,778,644 D84N probably damaging Het
Ubr1 T A 2: 120,906,946 Q1039L probably damaging Het
Ubr4 A G 4: 139,410,860 probably benign Het
Vmn1r74 T C 7: 11,847,315 Y181H possibly damaging Het
Vmn2r13 T C 5: 109,156,529 T679A probably benign Het
Vmn2r91 A T 17: 18,105,450 Y110F probably damaging Het
Zbtb40 A C 4: 137,018,531 S64A probably benign Het
Zfp184 T A 13: 21,947,082 probably benign Het
Other mutations in Thbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Thbs1 APN 2 118122973 missense probably damaging 1.00
IGL00920:Thbs1 APN 2 118113201 missense probably damaging 0.99
IGL01295:Thbs1 APN 2 118118327 missense possibly damaging 0.88
IGL01649:Thbs1 APN 2 118114982 missense probably benign
IGL02077:Thbs1 APN 2 118113110 missense probably benign 0.00
IGL02251:Thbs1 APN 2 118113518 missense probably benign 0.00
IGL02263:Thbs1 APN 2 118119880 missense probably benign 0.06
IGL02392:Thbs1 APN 2 118114660 missense probably benign
IGL02393:Thbs1 APN 2 118123099 missense possibly damaging 0.87
IGL02411:Thbs1 APN 2 118114970 missense probably benign
IGL02659:Thbs1 APN 2 118114792 missense probably benign 0.29
Stark UTSW 2 118121237 critical splice donor site probably null
R0014:Thbs1 UTSW 2 118113350 missense possibly damaging 0.51
R0042:Thbs1 UTSW 2 118122877 missense probably damaging 1.00
R0064:Thbs1 UTSW 2 118123914 critical splice acceptor site probably null
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0316:Thbs1 UTSW 2 118117574 missense probably damaging 1.00
R0678:Thbs1 UTSW 2 118122906 missense probably damaging 1.00
R1037:Thbs1 UTSW 2 118123051 missense probably damaging 1.00
R1440:Thbs1 UTSW 2 118114355 missense probably damaging 1.00
R1454:Thbs1 UTSW 2 118122672 missense probably damaging 1.00
R1571:Thbs1 UTSW 2 118119197 missense probably damaging 0.99
R1702:Thbs1 UTSW 2 118113442 missense probably benign
R2035:Thbs1 UTSW 2 118118340 critical splice donor site probably null
R2068:Thbs1 UTSW 2 118123537 nonsense probably null
R2171:Thbs1 UTSW 2 118122579 missense probably damaging 1.00
R2844:Thbs1 UTSW 2 118117628 missense probably benign 0.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R3620:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3621:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3726:Thbs1 UTSW 2 118114710 missense probably benign 0.02
R4499:Thbs1 UTSW 2 118119950 missense possibly damaging 0.82
R4524:Thbs1 UTSW 2 118122979 missense probably damaging 1.00
R4576:Thbs1 UTSW 2 118119416 missense probably damaging 0.97
R4596:Thbs1 UTSW 2 118114755 missense possibly damaging 0.80
R4646:Thbs1 UTSW 2 118118329 missense probably benign 0.15
R4783:Thbs1 UTSW 2 118114792 missense probably benign 0.04
R4836:Thbs1 UTSW 2 118115018 missense possibly damaging 0.91
R4943:Thbs1 UTSW 2 118113449 missense probably damaging 1.00
R4967:Thbs1 UTSW 2 118114778 missense probably benign
R5014:Thbs1 UTSW 2 118120037 critical splice donor site probably null
R5062:Thbs1 UTSW 2 118121237 critical splice donor site probably null
R5363:Thbs1 UTSW 2 118122666 missense probably damaging 1.00
R5420:Thbs1 UTSW 2 118113155 missense possibly damaging 0.83
R5432:Thbs1 UTSW 2 118114683 missense probably benign 0.25
R5788:Thbs1 UTSW 2 118122508 missense probably damaging 1.00
R6221:Thbs1 UTSW 2 118119997 missense probably damaging 1.00
R6327:Thbs1 UTSW 2 118112656 missense unknown
R6466:Thbs1 UTSW 2 118119847 missense probably damaging 1.00
R6480:Thbs1 UTSW 2 118119117 missense probably damaging 1.00
R6794:Thbs1 UTSW 2 118120038 splice site probably null
R6983:Thbs1 UTSW 2 118119952 missense probably damaging 1.00
X0019:Thbs1 UTSW 2 118112982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAGGATGCAGCTTCCCTCGCTC -3'
(R):5'- TTTGCCGTTGGAGACCACACTG -3'

Sequencing Primer
(F):5'- CAGCTTTCCATAATTGCCATTATTG -3'
(R):5'- TTCATCTGCCTCAAGGAAGC -3'
Posted On2013-04-24