Incidental Mutation 'R4094:Tigd4'
ID317783
Institutional Source Beutler Lab
Gene Symbol Tigd4
Ensembl Gene ENSMUSG00000047819
Gene Nametigger transposable element derived 4
SynonymsTigd4, C130063O11Rik
MMRRC Submission 041628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R4094 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location84593574-84597032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84594640 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 288 (D288G)
Ref Sequence ENSEMBL: ENSMUSP00000052320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062623] [ENSMUST00000154148]
Predicted Effect probably damaging
Transcript: ENSMUST00000062623
AA Change: D288G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052320
Gene: ENSMUSG00000047819
AA Change: D288G

DomainStartEndE-ValueType
Pfam:CENP-B_N 15 67 9e-14 PFAM
CENPB 81 146 5.52e-16 SMART
Pfam:DDE_1 211 375 4.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,180,366 C1500R probably damaging Het
Amz1 A T 5: 140,752,166 M93L probably damaging Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Bsn A C 9: 108,113,870 V1561G probably damaging Het
Cadm2 A T 16: 66,882,797 N49K probably damaging Het
Cct8 T G 16: 87,487,628 I283L possibly damaging Het
Cdc25b A G 2: 131,189,117 M121V probably benign Het
Cpne4 A G 9: 104,686,535 D37G probably damaging Het
Cym A G 3: 107,214,266 S237P probably benign Het
Dhx35 T A 2: 158,842,356 I517N probably damaging Het
Ehf T C 2: 103,290,750 probably benign Het
Erp29 A G 5: 121,452,282 probably benign Het
Fam160a2 T C 7: 105,388,218 D386G probably damaging Het
Fgd6 C A 10: 94,043,434 P50Q probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Frmd4a A G 2: 4,611,032 Y1031C probably damaging Het
Gna13 T A 11: 109,396,416 I355N probably damaging Het
Hgs T A 11: 120,469,033 L21* probably null Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Itga2 T C 13: 114,870,625 D389G probably benign Het
Kdm1b T C 13: 47,063,020 C289R probably damaging Het
Kdm4c T A 4: 74,311,678 D237E probably benign Het
Lilr4b A T 10: 51,481,410 E114V probably damaging Het
Loxl1 G A 9: 58,312,456 T144I probably damaging Het
Macf1 C T 4: 123,459,269 R1784Q probably benign Het
Maml2 G A 9: 13,620,153 S221N probably benign Het
Map3k1 A G 13: 111,756,162 M853T possibly damaging Het
Micu3 T G 8: 40,335,888 S147A probably null Het
Nccrp1 T C 7: 28,544,226 Y261C possibly damaging Het
Olfr1030 A G 2: 85,984,218 Y126C probably damaging Het
Olfr1049 T C 2: 86,255,330 D121G probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr611 T A 7: 103,518,037 I116F possibly damaging Het
Pclo C A 5: 14,855,645 T4963N unknown Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Plcg1 A G 2: 160,747,841 E95G probably damaging Het
Ppargc1a T C 5: 51,490,064 N276S possibly damaging Het
Prr12 A G 7: 45,047,947 L848P unknown Het
Ptcd2 A G 13: 99,332,449 I202T probably damaging Het
Rab27a A C 9: 73,075,544 I44L probably damaging Het
Rbfox2 A T 15: 77,132,725 S82T probably damaging Het
Rsbn1 T A 3: 103,928,658 F337L probably damaging Het
Samd8 T C 14: 21,793,045 I414T probably damaging Het
Sema3e A G 5: 14,233,690 I478V probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc2a3 A T 6: 122,735,568 I239N probably benign Het
Spc25 G A 2: 69,202,631 S50L probably damaging Het
St8sia4 A T 1: 95,627,686 S206R possibly damaging Het
Syngr3 G A 17: 24,689,843 probably benign Het
Trim34b A G 7: 104,334,588 M251V probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ttn T C 2: 76,900,516 probably benign Het
Vmp1 A G 11: 86,643,580 I167T probably benign Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Zscan4f A T 7: 11,401,258 N197I probably damaging Het
Other mutations in Tigd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01791:Tigd4 APN 3 84594745 missense probably damaging 1.00
R0080:Tigd4 UTSW 3 84594145 missense probably benign 0.19
R0320:Tigd4 UTSW 3 84595174 missense probably benign
R0347:Tigd4 UTSW 3 84593860 missense probably damaging 1.00
R1875:Tigd4 UTSW 3 84595087 missense probably benign 0.00
R1876:Tigd4 UTSW 3 84593935 nonsense probably null
R2142:Tigd4 UTSW 3 84594363 missense possibly damaging 0.95
R2258:Tigd4 UTSW 3 84594293 missense probably benign 0.00
R2519:Tigd4 UTSW 3 84593914 missense probably damaging 1.00
R2866:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R2867:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R2867:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R3974:Tigd4 UTSW 3 84595278 missense possibly damaging 0.82
R4967:Tigd4 UTSW 3 84595153 missense probably benign 0.03
R5155:Tigd4 UTSW 3 84594663 missense possibly damaging 0.96
R5878:Tigd4 UTSW 3 84594442 missense probably benign 0.09
R6174:Tigd4 UTSW 3 84595267 missense probably benign 0.02
R6960:Tigd4 UTSW 3 84594116 missense probably damaging 1.00
R7414:Tigd4 UTSW 3 84593821 missense probably benign 0.37
R7445:Tigd4 UTSW 3 84595164 missense probably benign 0.01
X0023:Tigd4 UTSW 3 84593857 missense probably damaging 1.00
X0064:Tigd4 UTSW 3 84594478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTTTGCTGATCATCGGG -3'
(R):5'- GCAGAGATGCAATGTATCAACTGC -3'

Sequencing Primer
(F):5'- CTTTGCTGATCATCGGGAAAAACC -3'
(R):5'- GCAATGTATCAACTGCATCTAGAAG -3'
Posted On2015-05-15