Incidental Mutation 'R4094:Rsbn1'
ID317784
Institutional Source Beutler Lab
Gene Symbol Rsbn1
Ensembl Gene ENSMUSG00000044098
Gene Namerosbin, round spermatid basic protein 1
SynonymsC230004D03Rik, Rsbp
MMRRC Submission 041628-MU
Accession Numbers

Genbank: NM_172684; MGI: 2444993

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4094 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103914120-103966636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103928658 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 337 (F337L)
Ref Sequence ENSEMBL: ENSMUSP00000069246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051139] [ENSMUST00000068879]
Predicted Effect probably damaging
Transcript: ENSMUST00000051139
AA Change: F337L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058934
Gene: ENSMUSG00000044098
AA Change: F337L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 466 477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068879
AA Change: F337L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069246
Gene: ENSMUSG00000044098
AA Change: F337L

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 131 156 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
low complexity region 252 261 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106806
AA Change: F290L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102418
Gene: ENSMUSG00000044098
AA Change: F290L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 466 477 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151927
AA Change: F298L
SMART Domains Protein: ENSMUSP00000115693
Gene: ENSMUSG00000044098
AA Change: F298L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000185731
AA Change: F13L
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(9) : Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,180,366 C1500R probably damaging Het
Amz1 A T 5: 140,752,166 M93L probably damaging Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Bsn A C 9: 108,113,870 V1561G probably damaging Het
Cadm2 A T 16: 66,882,797 N49K probably damaging Het
Cct8 T G 16: 87,487,628 I283L possibly damaging Het
Cdc25b A G 2: 131,189,117 M121V probably benign Het
Cpne4 A G 9: 104,686,535 D37G probably damaging Het
Cym A G 3: 107,214,266 S237P probably benign Het
Dhx35 T A 2: 158,842,356 I517N probably damaging Het
Ehf T C 2: 103,290,750 probably benign Het
Erp29 A G 5: 121,452,282 probably benign Het
Fam160a2 T C 7: 105,388,218 D386G probably damaging Het
Fgd6 C A 10: 94,043,434 P50Q probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Frmd4a A G 2: 4,611,032 Y1031C probably damaging Het
Gna13 T A 11: 109,396,416 I355N probably damaging Het
Hgs T A 11: 120,469,033 L21* probably null Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Itga2 T C 13: 114,870,625 D389G probably benign Het
Kdm1b T C 13: 47,063,020 C289R probably damaging Het
Kdm4c T A 4: 74,311,678 D237E probably benign Het
Lilr4b A T 10: 51,481,410 E114V probably damaging Het
Loxl1 G A 9: 58,312,456 T144I probably damaging Het
Macf1 C T 4: 123,459,269 R1784Q probably benign Het
Maml2 G A 9: 13,620,153 S221N probably benign Het
Map3k1 A G 13: 111,756,162 M853T possibly damaging Het
Micu3 T G 8: 40,335,888 S147A probably null Het
Nccrp1 T C 7: 28,544,226 Y261C possibly damaging Het
Olfr1030 A G 2: 85,984,218 Y126C probably damaging Het
Olfr1049 T C 2: 86,255,330 D121G probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr611 T A 7: 103,518,037 I116F possibly damaging Het
Pclo C A 5: 14,855,645 T4963N unknown Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Plcg1 A G 2: 160,747,841 E95G probably damaging Het
Ppargc1a T C 5: 51,490,064 N276S possibly damaging Het
Prr12 A G 7: 45,047,947 L848P unknown Het
Ptcd2 A G 13: 99,332,449 I202T probably damaging Het
Rab27a A C 9: 73,075,544 I44L probably damaging Het
Rbfox2 A T 15: 77,132,725 S82T probably damaging Het
Samd8 T C 14: 21,793,045 I414T probably damaging Het
Sema3e A G 5: 14,233,690 I478V probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc2a3 A T 6: 122,735,568 I239N probably benign Het
Spc25 G A 2: 69,202,631 S50L probably damaging Het
St8sia4 A T 1: 95,627,686 S206R possibly damaging Het
Syngr3 G A 17: 24,689,843 probably benign Het
Tigd4 A G 3: 84,594,640 D288G probably damaging Het
Trim34b A G 7: 104,334,588 M251V probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ttn T C 2: 76,900,516 probably benign Het
Vmp1 A G 11: 86,643,580 I167T probably benign Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Zscan4f A T 7: 11,401,258 N197I probably damaging Het
Other mutations in Rsbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rsbn1 APN 3 103928690 missense probably benign 0.01
IGL00725:Rsbn1 APN 3 103928821 missense probably damaging 0.96
IGL01682:Rsbn1 APN 3 103962380 missense probably benign 0.03
IGL01978:Rsbn1 APN 3 103961500 missense probably damaging 0.99
IGL02281:Rsbn1 APN 3 103962461 missense probably damaging 0.99
IGL02615:Rsbn1 APN 3 103953752 missense probably damaging 1.00
IGL02902:Rsbn1 APN 3 103953656 missense possibly damaging 0.62
IGL02903:Rsbn1 APN 3 103928569 missense probably damaging 1.00
IGL02927:Rsbn1 APN 3 103962352 missense probably benign
IGL03007:Rsbn1 APN 3 103928879 missense probably damaging 1.00
IGL03062:Rsbn1 APN 3 103953629 intron probably benign
IGL03345:Rsbn1 APN 3 103915150 missense possibly damaging 0.78
F2404:Rsbn1 UTSW 3 103914576 nonsense probably null
R0277:Rsbn1 UTSW 3 103914581 missense possibly damaging 0.66
R0815:Rsbn1 UTSW 3 103954153 missense probably damaging 0.98
R1760:Rsbn1 UTSW 3 103960031 missense probably damaging 1.00
R1801:Rsbn1 UTSW 3 103914872 missense probably damaging 0.97
R2021:Rsbn1 UTSW 3 103914473 missense probably benign
R2078:Rsbn1 UTSW 3 103961523 missense probably damaging 1.00
R2330:Rsbn1 UTSW 3 103914500 missense probably damaging 0.97
R3956:Rsbn1 UTSW 3 103928675 missense probably damaging 0.99
R4649:Rsbn1 UTSW 3 103953780 splice site probably null
R4720:Rsbn1 UTSW 3 103929020 missense possibly damaging 0.92
R5299:Rsbn1 UTSW 3 103914490 missense probably benign 0.01
R5505:Rsbn1 UTSW 3 103928943 missense probably damaging 1.00
R5699:Rsbn1 UTSW 3 103962485 missense probably benign 0.02
R5775:Rsbn1 UTSW 3 103962572 missense possibly damaging 0.80
R6509:Rsbn1 UTSW 3 103960032 missense probably damaging 1.00
R6629:Rsbn1 UTSW 3 103928441 missense probably damaging 1.00
R7070:Rsbn1 UTSW 3 103928983 missense probably damaging 1.00
R7116:Rsbn1 UTSW 3 103914576 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACAAACCGTCTGTGCTGG -3'
(R):5'- CTAACGCATAGTACGCAGCG -3'

Sequencing Primer
(F):5'- TCTGTGCTGGCCTGACC -3'
(R):5'- AACGCATAGTACGCAGCGTTTTTC -3'
Posted On2015-05-15