Incidental Mutation 'R4094:Cym'
ID317785
Institutional Source Beutler Lab
Gene Symbol Cym
Ensembl Gene ENSMUSG00000046213
Gene Namechymosin
SynonymsLOC229697, Gm131
MMRRC Submission 041628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4094 (G1)
Quality Score192
Status Not validated
Chromosome3
Chromosomal Location107211293-107221732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107214266 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 237 (S237P)
Ref Sequence ENSEMBL: ENSMUSP00000029504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029504]
Predicted Effect probably benign
Transcript: ENSMUST00000029504
AA Change: S237P

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029504
Gene: ENSMUSG00000046213
AA Change: S237P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 19 45 1.5e-16 PFAM
Pfam:Asp 73 378 5.8e-110 PFAM
Pfam:TAXi_N 74 228 3.6e-12 PFAM
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,180,366 C1500R probably damaging Het
Amz1 A T 5: 140,752,166 M93L probably damaging Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Bsn A C 9: 108,113,870 V1561G probably damaging Het
Cadm2 A T 16: 66,882,797 N49K probably damaging Het
Cct8 T G 16: 87,487,628 I283L possibly damaging Het
Cdc25b A G 2: 131,189,117 M121V probably benign Het
Cpne4 A G 9: 104,686,535 D37G probably damaging Het
Dhx35 T A 2: 158,842,356 I517N probably damaging Het
Ehf T C 2: 103,290,750 probably benign Het
Erp29 A G 5: 121,452,282 probably benign Het
Fam160a2 T C 7: 105,388,218 D386G probably damaging Het
Fgd6 C A 10: 94,043,434 P50Q probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Frmd4a A G 2: 4,611,032 Y1031C probably damaging Het
Gna13 T A 11: 109,396,416 I355N probably damaging Het
Hgs T A 11: 120,469,033 L21* probably null Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Itga2 T C 13: 114,870,625 D389G probably benign Het
Kdm1b T C 13: 47,063,020 C289R probably damaging Het
Kdm4c T A 4: 74,311,678 D237E probably benign Het
Lilr4b A T 10: 51,481,410 E114V probably damaging Het
Loxl1 G A 9: 58,312,456 T144I probably damaging Het
Macf1 C T 4: 123,459,269 R1784Q probably benign Het
Maml2 G A 9: 13,620,153 S221N probably benign Het
Map3k1 A G 13: 111,756,162 M853T possibly damaging Het
Micu3 T G 8: 40,335,888 S147A probably null Het
Nccrp1 T C 7: 28,544,226 Y261C possibly damaging Het
Olfr1030 A G 2: 85,984,218 Y126C probably damaging Het
Olfr1049 T C 2: 86,255,330 D121G probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr611 T A 7: 103,518,037 I116F possibly damaging Het
Pclo C A 5: 14,855,645 T4963N unknown Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Plcg1 A G 2: 160,747,841 E95G probably damaging Het
Ppargc1a T C 5: 51,490,064 N276S possibly damaging Het
Prr12 A G 7: 45,047,947 L848P unknown Het
Ptcd2 A G 13: 99,332,449 I202T probably damaging Het
Rab27a A C 9: 73,075,544 I44L probably damaging Het
Rbfox2 A T 15: 77,132,725 S82T probably damaging Het
Rsbn1 T A 3: 103,928,658 F337L probably damaging Het
Samd8 T C 14: 21,793,045 I414T probably damaging Het
Sema3e A G 5: 14,233,690 I478V probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc2a3 A T 6: 122,735,568 I239N probably benign Het
Spc25 G A 2: 69,202,631 S50L probably damaging Het
St8sia4 A T 1: 95,627,686 S206R possibly damaging Het
Syngr3 G A 17: 24,689,843 probably benign Het
Tigd4 A G 3: 84,594,640 D288G probably damaging Het
Trim34b A G 7: 104,334,588 M251V probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ttn T C 2: 76,900,516 probably benign Het
Vmp1 A G 11: 86,643,580 I167T probably benign Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Zscan4f A T 7: 11,401,258 N197I probably damaging Het
Other mutations in Cym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Cym APN 3 107214285 missense probably damaging 0.97
IGL02480:Cym APN 3 107213522 missense probably benign 0.00
IGL03224:Cym APN 3 107218732 missense possibly damaging 0.69
R1466:Cym UTSW 3 107213458 missense probably damaging 1.00
R1466:Cym UTSW 3 107213458 missense probably damaging 1.00
R1753:Cym UTSW 3 107213425 missense possibly damaging 0.91
R1768:Cym UTSW 3 107213500 missense probably damaging 1.00
R1851:Cym UTSW 3 107218714 missense probably benign 0.20
R4093:Cym UTSW 3 107214266 missense probably benign 0.06
R4114:Cym UTSW 3 107219749 missense probably damaging 1.00
R4583:Cym UTSW 3 107211402 missense probably damaging 1.00
R4782:Cym UTSW 3 107216097 missense possibly damaging 0.60
R5844:Cym UTSW 3 107219764 missense probably benign 0.02
R5953:Cym UTSW 3 107213467 missense probably damaging 1.00
R7133:Cym UTSW 3 107214214 missense probably damaging 1.00
R7298:Cym UTSW 3 107219693 missense probably benign 0.07
R7563:Cym UTSW 3 107214232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATAGAACTGCTCAGCAC -3'
(R):5'- CAGTGAAAGGCCTCTAGGTC -3'

Sequencing Primer
(F):5'- TAGAACTGCTCAGCACGGTGC -3'
(R):5'- AGGTCTCCACCCATCTGC -3'
Posted On2015-05-15