Incidental Mutation 'R4094:Sfswap'
ID317793
Institutional Source Beutler Lab
Gene Symbol Sfswap
Ensembl Gene ENSMUSG00000029439
Gene Namesplicing factor SWAP
SynonymsSfrs8, 6330437E22Rik, 1190005N23Rik
MMRRC Submission 041628-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4094 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129501221-129571384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129560741 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 821 (S821G)
Ref Sequence ENSEMBL: ENSMUSP00000062413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053737
AA Change: S821G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439
AA Change: S821G

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 157 1.15e-57 SMART
low complexity region 160 170 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
SWAP 209 262 3.94e-19 SMART
low complexity region 286 293 N/A INTRINSIC
low complexity region 333 352 N/A INTRINSIC
low complexity region 397 441 N/A INTRINSIC
SWAP 456 507 9.55e-18 SMART
low complexity region 513 532 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 598 607 N/A INTRINSIC
coiled coil region 631 686 N/A INTRINSIC
low complexity region 741 788 N/A INTRINSIC
low complexity region 797 821 N/A INTRINSIC
low complexity region 840 865 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
low complexity region 889 905 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196287
Predicted Effect probably benign
Transcript: ENSMUST00000196698
SMART Domains Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 121 1.8e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199925
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,180,366 C1500R probably damaging Het
Amz1 A T 5: 140,752,166 M93L probably damaging Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Bsn A C 9: 108,113,870 V1561G probably damaging Het
Cadm2 A T 16: 66,882,797 N49K probably damaging Het
Cct8 T G 16: 87,487,628 I283L possibly damaging Het
Cdc25b A G 2: 131,189,117 M121V probably benign Het
Cpne4 A G 9: 104,686,535 D37G probably damaging Het
Cym A G 3: 107,214,266 S237P probably benign Het
Dhx35 T A 2: 158,842,356 I517N probably damaging Het
Ehf T C 2: 103,290,750 probably benign Het
Erp29 A G 5: 121,452,282 probably benign Het
Fam160a2 T C 7: 105,388,218 D386G probably damaging Het
Fgd6 C A 10: 94,043,434 P50Q probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Frmd4a A G 2: 4,611,032 Y1031C probably damaging Het
Gna13 T A 11: 109,396,416 I355N probably damaging Het
Hgs T A 11: 120,469,033 L21* probably null Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Itga2 T C 13: 114,870,625 D389G probably benign Het
Kdm1b T C 13: 47,063,020 C289R probably damaging Het
Kdm4c T A 4: 74,311,678 D237E probably benign Het
Lilr4b A T 10: 51,481,410 E114V probably damaging Het
Loxl1 G A 9: 58,312,456 T144I probably damaging Het
Macf1 C T 4: 123,459,269 R1784Q probably benign Het
Maml2 G A 9: 13,620,153 S221N probably benign Het
Map3k1 A G 13: 111,756,162 M853T possibly damaging Het
Micu3 T G 8: 40,335,888 S147A probably null Het
Nccrp1 T C 7: 28,544,226 Y261C possibly damaging Het
Olfr1030 A G 2: 85,984,218 Y126C probably damaging Het
Olfr1049 T C 2: 86,255,330 D121G probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr611 T A 7: 103,518,037 I116F possibly damaging Het
Pclo C A 5: 14,855,645 T4963N unknown Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Plcg1 A G 2: 160,747,841 E95G probably damaging Het
Ppargc1a T C 5: 51,490,064 N276S possibly damaging Het
Prr12 A G 7: 45,047,947 L848P unknown Het
Ptcd2 A G 13: 99,332,449 I202T probably damaging Het
Rab27a A C 9: 73,075,544 I44L probably damaging Het
Rbfox2 A T 15: 77,132,725 S82T probably damaging Het
Rsbn1 T A 3: 103,928,658 F337L probably damaging Het
Samd8 T C 14: 21,793,045 I414T probably damaging Het
Sema3e A G 5: 14,233,690 I478V probably benign Het
Slc2a3 A T 6: 122,735,568 I239N probably benign Het
Spc25 G A 2: 69,202,631 S50L probably damaging Het
St8sia4 A T 1: 95,627,686 S206R possibly damaging Het
Syngr3 G A 17: 24,689,843 probably benign Het
Tigd4 A G 3: 84,594,640 D288G probably damaging Het
Trim34b A G 7: 104,334,588 M251V probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ttn T C 2: 76,900,516 probably benign Het
Vmp1 A G 11: 86,643,580 I167T probably benign Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Zscan4f A T 7: 11,401,258 N197I probably damaging Het
Other mutations in Sfswap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Sfswap APN 5 129513233 missense probably damaging 1.00
IGL02064:Sfswap APN 5 129560796 missense probably benign 0.17
IGL02083:Sfswap APN 5 129539791 missense probably benign
IGL02378:Sfswap APN 5 129539604 missense probably damaging 1.00
FR4340:Sfswap UTSW 5 129569751 unclassified probably benign
FR4342:Sfswap UTSW 5 129569757 unclassified probably benign
FR4449:Sfswap UTSW 5 129569748 unclassified probably benign
FR4449:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569755 unclassified probably benign
FR4737:Sfswap UTSW 5 129569756 unclassified probably benign
FR4976:Sfswap UTSW 5 129569751 unclassified probably benign
I1329:Sfswap UTSW 5 129507137 unclassified probably benign
P0033:Sfswap UTSW 5 129539755 missense possibly damaging 0.60
R0184:Sfswap UTSW 5 129507189 missense probably damaging 0.97
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0414:Sfswap UTSW 5 129504051 missense possibly damaging 0.83
R0415:Sfswap UTSW 5 129504126 missense probably damaging 1.00
R0570:Sfswap UTSW 5 129503978 splice site probably benign
R1018:Sfswap UTSW 5 129554576 missense possibly damaging 0.91
R1173:Sfswap UTSW 5 129507143 critical splice acceptor site probably null
R1298:Sfswap UTSW 5 129541378 missense probably benign 0.14
R1723:Sfswap UTSW 5 129539694 missense probably benign
R1783:Sfswap UTSW 5 129513240 missense possibly damaging 0.92
R1828:Sfswap UTSW 5 129513084 missense probably damaging 1.00
R1879:Sfswap UTSW 5 129541328 missense probably benign 0.01
R2078:Sfswap UTSW 5 129516107 missense possibly damaging 0.81
R2349:Sfswap UTSW 5 129569738 missense possibly damaging 0.87
R3757:Sfswap UTSW 5 129513234 missense probably damaging 1.00
R4093:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4095:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4785:Sfswap UTSW 5 129513083 missense probably damaging 1.00
R5139:Sfswap UTSW 5 129571009 missense possibly damaging 0.73
R5355:Sfswap UTSW 5 129539746 missense probably benign 0.09
R5481:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5600:Sfswap UTSW 5 129513158 missense probably damaging 1.00
R5686:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5906:Sfswap UTSW 5 129542043 missense probably benign 0.22
R6332:Sfswap UTSW 5 129571041 missense possibly damaging 0.91
R6738:Sfswap UTSW 5 129541441 missense probably damaging 0.98
R6743:Sfswap UTSW 5 129550819 nonsense probably null
R7371:Sfswap UTSW 5 129543241 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAAAGATGCAGGGCCCATC -3'
(R):5'- ACAGGCATGGACACACTGTG -3'

Sequencing Primer
(F):5'- AGGGCCCATCTGCGCAG -3'
(R):5'- ATGGACACACTGTGCCCTG -3'
Posted On2015-05-15