Incidental Mutation 'R4094:Slc2a3'
ID317795
Institutional Source Beutler Lab
Gene Symbol Slc2a3
Ensembl Gene ENSMUSG00000003153
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 3
SynonymsGlut-3, Glut3
MMRRC Submission 041628-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4094 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location122727809-122801640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122735568 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 239 (I239N)
Ref Sequence ENSEMBL: ENSMUSP00000032476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032476] [ENSMUST00000165884] [ENSMUST00000166135] [ENSMUST00000168801] [ENSMUST00000170724] [ENSMUST00000171541]
Predicted Effect probably benign
Transcript: ENSMUST00000032476
AA Change: I239N

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032476
Gene: ENSMUSG00000003153
AA Change: I239N

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 465 5.9e-165 PFAM
Pfam:MFS_1 16 385 7.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165884
SMART Domains Protein: ENSMUSP00000129925
Gene: ENSMUSG00000003153

DomainStartEndE-ValueType
Pfam:MFS_1 13 163 3.6e-12 PFAM
Pfam:Sugar_tr 15 163 6.9e-49 PFAM
Pfam:MFS_2 43 148 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166135
SMART Domains Protein: ENSMUSP00000132586
Gene: ENSMUSG00000003153

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 63 9.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168704
Predicted Effect probably benign
Transcript: ENSMUST00000168801
SMART Domains Protein: ENSMUSP00000129604
Gene: ENSMUSG00000003153

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 70 1.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169979
Predicted Effect probably benign
Transcript: ENSMUST00000170724
SMART Domains Protein: ENSMUSP00000128076
Gene: ENSMUSG00000003153

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 89 5.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171541
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutations cause embryonic lethality. Heterozygotes for a null allele show partial perinatal lethality and impaired placental transport. Heterozygotes for a gene trap allele show abnormal brain wave patterns, increased startle reflex, reduced prepulse inhibition and increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,180,366 C1500R probably damaging Het
Amz1 A T 5: 140,752,166 M93L probably damaging Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Bsn A C 9: 108,113,870 V1561G probably damaging Het
Cadm2 A T 16: 66,882,797 N49K probably damaging Het
Cct8 T G 16: 87,487,628 I283L possibly damaging Het
Cdc25b A G 2: 131,189,117 M121V probably benign Het
Cpne4 A G 9: 104,686,535 D37G probably damaging Het
Cym A G 3: 107,214,266 S237P probably benign Het
Dhx35 T A 2: 158,842,356 I517N probably damaging Het
Ehf T C 2: 103,290,750 probably benign Het
Erp29 A G 5: 121,452,282 probably benign Het
Fam160a2 T C 7: 105,388,218 D386G probably damaging Het
Fgd6 C A 10: 94,043,434 P50Q probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Frmd4a A G 2: 4,611,032 Y1031C probably damaging Het
Gna13 T A 11: 109,396,416 I355N probably damaging Het
Hgs T A 11: 120,469,033 L21* probably null Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Itga2 T C 13: 114,870,625 D389G probably benign Het
Kdm1b T C 13: 47,063,020 C289R probably damaging Het
Kdm4c T A 4: 74,311,678 D237E probably benign Het
Lilr4b A T 10: 51,481,410 E114V probably damaging Het
Loxl1 G A 9: 58,312,456 T144I probably damaging Het
Macf1 C T 4: 123,459,269 R1784Q probably benign Het
Maml2 G A 9: 13,620,153 S221N probably benign Het
Map3k1 A G 13: 111,756,162 M853T possibly damaging Het
Micu3 T G 8: 40,335,888 S147A probably null Het
Nccrp1 T C 7: 28,544,226 Y261C possibly damaging Het
Olfr1030 A G 2: 85,984,218 Y126C probably damaging Het
Olfr1049 T C 2: 86,255,330 D121G probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr611 T A 7: 103,518,037 I116F possibly damaging Het
Pclo C A 5: 14,855,645 T4963N unknown Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Plcg1 A G 2: 160,747,841 E95G probably damaging Het
Ppargc1a T C 5: 51,490,064 N276S possibly damaging Het
Prr12 A G 7: 45,047,947 L848P unknown Het
Ptcd2 A G 13: 99,332,449 I202T probably damaging Het
Rab27a A C 9: 73,075,544 I44L probably damaging Het
Rbfox2 A T 15: 77,132,725 S82T probably damaging Het
Rsbn1 T A 3: 103,928,658 F337L probably damaging Het
Samd8 T C 14: 21,793,045 I414T probably damaging Het
Sema3e A G 5: 14,233,690 I478V probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Spc25 G A 2: 69,202,631 S50L probably damaging Het
St8sia4 A T 1: 95,627,686 S206R possibly damaging Het
Syngr3 G A 17: 24,689,843 probably benign Het
Tigd4 A G 3: 84,594,640 D288G probably damaging Het
Trim34b A G 7: 104,334,588 M251V probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ttn T C 2: 76,900,516 probably benign Het
Vmp1 A G 11: 86,643,580 I167T probably benign Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Zscan4f A T 7: 11,401,258 N197I probably damaging Het
Other mutations in Slc2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Slc2a3 APN 6 122729956 missense probably benign
IGL02056:Slc2a3 APN 6 122735478 missense probably damaging 0.99
IGL02267:Slc2a3 APN 6 122739972 missense probably benign 0.00
IGL02873:Slc2a3 APN 6 122740414 missense probably damaging 0.98
IGL03275:Slc2a3 APN 6 122736742 critical splice acceptor site probably null
R1014:Slc2a3 UTSW 6 122731566 missense possibly damaging 0.77
R1464:Slc2a3 UTSW 6 122737310 splice site probably benign
R1920:Slc2a3 UTSW 6 122736741 missense probably damaging 0.99
R1990:Slc2a3 UTSW 6 122736735 missense probably damaging 1.00
R3809:Slc2a3 UTSW 6 122732429 missense probably benign 0.03
R4537:Slc2a3 UTSW 6 122737104 missense probably damaging 1.00
R5093:Slc2a3 UTSW 6 122737237 missense probably damaging 0.99
R5186:Slc2a3 UTSW 6 122735583 missense probably damaging 1.00
R5784:Slc2a3 UTSW 6 122735417 splice site probably null
Predicted Primers PCR Primer
(F):5'- GACTTCGGGAGACTATTGCTGG -3'
(R):5'- CTGAGTCAGGACCTGAGAATG -3'

Sequencing Primer
(F):5'- AGACTATTGCTGGGCGTG -3'
(R):5'- TGAGTCAGGACCTGAGAATGAAGTAG -3'
Posted On2015-05-15