Incidental Mutation 'R4094:Hgs'
ID317814
Institutional Source Beutler Lab
Gene Symbol Hgs
Ensembl Gene ENSMUSG00000116045
Gene Name
SynonymsHrs
MMRRC Submission 041628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R4094 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120467635-120483984 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 120469033 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 21 (L21*)
Ref Sequence ENSEMBL: ENSMUSP00000119396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026900] [ENSMUST00000058370] [ENSMUST00000076921] [ENSMUST00000106203] [ENSMUST00000106205] [ENSMUST00000140862]
Predicted Effect probably null
Transcript: ENSMUST00000026900
AA Change: L21*
SMART Domains Protein: ENSMUSP00000026900
Gene: ENSMUSG00000116045
AA Change: L21*

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 406 500 1.2e-41 PFAM
low complexity region 637 658 N/A INTRINSIC
low complexity region 746 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058370
SMART Domains Protein: ENSMUSP00000062540
Gene: ENSMUSG00000049957

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
coiled coil region 160 189 N/A INTRINSIC
low complexity region 219 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076921
SMART Domains Protein: ENSMUSP00000076188
Gene: ENSMUSG00000057594

DomainStartEndE-ValueType
Pfam:Arf 1 169 1.4e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106203
AA Change: L21*
SMART Domains Protein: ENSMUSP00000101809
Gene: ENSMUSG00000025793
AA Change: L21*

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 405 500 2.2e-48 PFAM
low complexity region 724 739 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106205
AA Change: L21*
SMART Domains Protein: ENSMUSP00000101811
Gene: ENSMUSG00000025793
AA Change: L21*

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 404 499 2.2e-48 PFAM
low complexity region 723 738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137639
Predicted Effect probably null
Transcript: ENSMUST00000140862
AA Change: L21*
SMART Domains Protein: ENSMUSP00000119396
Gene: ENSMUSG00000025793
AA Change: L21*

DomainStartEndE-ValueType
VHS 8 123 1.29e-48 SMART
FYVE 139 205 1.81e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154136
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene regulates endosomal sorting and plays a critical role in the recycling and degradation of membrane receptors. The encoded protein sorts monoubiquitinated membrane proteins into the multivesicular body, targeting these proteins for lysosome-dependent degradation. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis with decreased size and no embryo turning. In addition, one allele shows cardia bifida, no foregut formation, failure of chorioallantoic fusion and neural tube,somite and allantois defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,180,366 C1500R probably damaging Het
Amz1 A T 5: 140,752,166 M93L probably damaging Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Bsn A C 9: 108,113,870 V1561G probably damaging Het
Cadm2 A T 16: 66,882,797 N49K probably damaging Het
Cct8 T G 16: 87,487,628 I283L possibly damaging Het
Cdc25b A G 2: 131,189,117 M121V probably benign Het
Cpne4 A G 9: 104,686,535 D37G probably damaging Het
Cym A G 3: 107,214,266 S237P probably benign Het
Dhx35 T A 2: 158,842,356 I517N probably damaging Het
Ehf T C 2: 103,290,750 probably benign Het
Erp29 A G 5: 121,452,282 probably benign Het
Fam160a2 T C 7: 105,388,218 D386G probably damaging Het
Fgd6 C A 10: 94,043,434 P50Q probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Frmd4a A G 2: 4,611,032 Y1031C probably damaging Het
Gna13 T A 11: 109,396,416 I355N probably damaging Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Itga2 T C 13: 114,870,625 D389G probably benign Het
Kdm1b T C 13: 47,063,020 C289R probably damaging Het
Kdm4c T A 4: 74,311,678 D237E probably benign Het
Lilr4b A T 10: 51,481,410 E114V probably damaging Het
Loxl1 G A 9: 58,312,456 T144I probably damaging Het
Macf1 C T 4: 123,459,269 R1784Q probably benign Het
Maml2 G A 9: 13,620,153 S221N probably benign Het
Map3k1 A G 13: 111,756,162 M853T possibly damaging Het
Micu3 T G 8: 40,335,888 S147A probably null Het
Nccrp1 T C 7: 28,544,226 Y261C possibly damaging Het
Olfr1030 A G 2: 85,984,218 Y126C probably damaging Het
Olfr1049 T C 2: 86,255,330 D121G probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr611 T A 7: 103,518,037 I116F possibly damaging Het
Pclo C A 5: 14,855,645 T4963N unknown Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Plcg1 A G 2: 160,747,841 E95G probably damaging Het
Ppargc1a T C 5: 51,490,064 N276S possibly damaging Het
Prr12 A G 7: 45,047,947 L848P unknown Het
Ptcd2 A G 13: 99,332,449 I202T probably damaging Het
Rab27a A C 9: 73,075,544 I44L probably damaging Het
Rbfox2 A T 15: 77,132,725 S82T probably damaging Het
Rsbn1 T A 3: 103,928,658 F337L probably damaging Het
Samd8 T C 14: 21,793,045 I414T probably damaging Het
Sema3e A G 5: 14,233,690 I478V probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc2a3 A T 6: 122,735,568 I239N probably benign Het
Spc25 G A 2: 69,202,631 S50L probably damaging Het
St8sia4 A T 1: 95,627,686 S206R possibly damaging Het
Syngr3 G A 17: 24,689,843 probably benign Het
Tigd4 A G 3: 84,594,640 D288G probably damaging Het
Trim34b A G 7: 104,334,588 M251V probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ttn T C 2: 76,900,516 probably benign Het
Vmp1 A G 11: 86,643,580 I167T probably benign Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Zscan4f A T 7: 11,401,258 N197I probably damaging Het
Other mutations in Hgs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Hgs APN 11 120475214 missense probably damaging 1.00
IGL01520:Hgs APN 11 120478348 missense probably damaging 1.00
IGL01532:Hgs APN 11 120477509 unclassified probably null
IGL02346:Hgs APN 11 120482551 missense probably damaging 0.99
IGL02808:Hgs APN 11 120469666 nonsense probably null
LCD18:Hgs UTSW 11 120469578 splice site probably benign
R0100:Hgs UTSW 11 120482852 missense possibly damaging 0.83
R0462:Hgs UTSW 11 120479144 missense possibly damaging 0.96
R0653:Hgs UTSW 11 120469078 missense probably damaging 1.00
R0719:Hgs UTSW 11 120471605 critical splice donor site probably null
R1482:Hgs UTSW 11 120480040 missense probably benign 0.09
R1757:Hgs UTSW 11 120480063 missense probably damaging 0.98
R1782:Hgs UTSW 11 120478505 missense probably damaging 1.00
R2311:Hgs UTSW 11 120479648 missense probably damaging 1.00
R4077:Hgs UTSW 11 120477376 missense probably damaging 1.00
R4078:Hgs UTSW 11 120483048 missense probably benign 0.04
R4079:Hgs UTSW 11 120483048 missense probably benign 0.04
R4204:Hgs UTSW 11 120477187 missense probably damaging 1.00
R4911:Hgs UTSW 11 120477202 missense probably damaging 0.98
R6477:Hgs UTSW 11 120469655 missense probably damaging 1.00
R6816:Hgs UTSW 11 120471571 missense probably damaging 1.00
R7264:Hgs UTSW 11 120474313 missense probably benign 0.00
X0024:Hgs UTSW 11 120477314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAGGATGCCATTTCCATG -3'
(R):5'- TAGCCTGACAGACCTCCTCAAG -3'

Sequencing Primer
(F):5'- CCATGGTTGTCAGTGTACTTCAAGAG -3'
(R):5'- CTCCTCAAGGAAATATCAGTGAGTC -3'
Posted On2015-05-15