Incidental Mutation 'R4094:Olfr282'
ID317826
Institutional Source Beutler Lab
Gene Symbol Olfr282
Ensembl Gene ENSMUSG00000063780
Gene Nameolfactory receptor 282
SynonymsMOR160-2, GA_x6K02T2NBG7-5293798-5292872
MMRRC Submission 041628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4094 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98431225-98438638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98437682 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 71 (L71P)
Ref Sequence ENSEMBL: ENSMUSP00000151156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075851] [ENSMUST00000205491] [ENSMUST00000213608] [ENSMUST00000215320]
Predicted Effect probably damaging
Transcript: ENSMUST00000075851
AA Change: L71P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075248
Gene: ENSMUSG00000063780
AA Change: L71P

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.6e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 217 5.7e-6 PFAM
Pfam:7tm_1 41 288 2.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205491
Predicted Effect probably damaging
Transcript: ENSMUST00000213608
AA Change: L71P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215320
AA Change: L71P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,180,366 C1500R probably damaging Het
Amz1 A T 5: 140,752,166 M93L probably damaging Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Bsn A C 9: 108,113,870 V1561G probably damaging Het
Cadm2 A T 16: 66,882,797 N49K probably damaging Het
Cct8 T G 16: 87,487,628 I283L possibly damaging Het
Cdc25b A G 2: 131,189,117 M121V probably benign Het
Cpne4 A G 9: 104,686,535 D37G probably damaging Het
Cym A G 3: 107,214,266 S237P probably benign Het
Dhx35 T A 2: 158,842,356 I517N probably damaging Het
Ehf T C 2: 103,290,750 probably benign Het
Erp29 A G 5: 121,452,282 probably benign Het
Fam160a2 T C 7: 105,388,218 D386G probably damaging Het
Fgd6 C A 10: 94,043,434 P50Q probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Frmd4a A G 2: 4,611,032 Y1031C probably damaging Het
Gna13 T A 11: 109,396,416 I355N probably damaging Het
Hgs T A 11: 120,469,033 L21* probably null Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Itga2 T C 13: 114,870,625 D389G probably benign Het
Kdm1b T C 13: 47,063,020 C289R probably damaging Het
Kdm4c T A 4: 74,311,678 D237E probably benign Het
Lilr4b A T 10: 51,481,410 E114V probably damaging Het
Loxl1 G A 9: 58,312,456 T144I probably damaging Het
Macf1 C T 4: 123,459,269 R1784Q probably benign Het
Maml2 G A 9: 13,620,153 S221N probably benign Het
Map3k1 A G 13: 111,756,162 M853T possibly damaging Het
Micu3 T G 8: 40,335,888 S147A probably null Het
Nccrp1 T C 7: 28,544,226 Y261C possibly damaging Het
Olfr1030 A G 2: 85,984,218 Y126C probably damaging Het
Olfr1049 T C 2: 86,255,330 D121G probably damaging Het
Olfr611 T A 7: 103,518,037 I116F possibly damaging Het
Pclo C A 5: 14,855,645 T4963N unknown Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Plcg1 A G 2: 160,747,841 E95G probably damaging Het
Ppargc1a T C 5: 51,490,064 N276S possibly damaging Het
Prr12 A G 7: 45,047,947 L848P unknown Het
Ptcd2 A G 13: 99,332,449 I202T probably damaging Het
Rab27a A C 9: 73,075,544 I44L probably damaging Het
Rbfox2 A T 15: 77,132,725 S82T probably damaging Het
Rsbn1 T A 3: 103,928,658 F337L probably damaging Het
Samd8 T C 14: 21,793,045 I414T probably damaging Het
Sema3e A G 5: 14,233,690 I478V probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc2a3 A T 6: 122,735,568 I239N probably benign Het
Spc25 G A 2: 69,202,631 S50L probably damaging Het
St8sia4 A T 1: 95,627,686 S206R possibly damaging Het
Syngr3 G A 17: 24,689,843 probably benign Het
Tigd4 A G 3: 84,594,640 D288G probably damaging Het
Trim34b A G 7: 104,334,588 M251V probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ttn T C 2: 76,900,516 probably benign Het
Vmp1 A G 11: 86,643,580 I167T probably benign Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Zscan4f A T 7: 11,401,258 N197I probably damaging Het
Other mutations in Olfr282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Olfr282 APN 15 98437649 missense possibly damaging 0.95
IGL02724:Olfr282 APN 15 98437779 missense probably benign 0.09
IGL03104:Olfr282 APN 15 98438246 missense possibly damaging 0.93
R0611:Olfr282 UTSW 15 98438287 missense possibly damaging 0.95
R3008:Olfr282 UTSW 15 98437976 missense probably damaging 1.00
R4093:Olfr282 UTSW 15 98437682 missense probably damaging 1.00
R4095:Olfr282 UTSW 15 98437682 missense probably damaging 1.00
R4579:Olfr282 UTSW 15 98437679 missense probably damaging 1.00
R4647:Olfr282 UTSW 15 98437576 missense probably benign 0.00
R5290:Olfr282 UTSW 15 98438332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATGGCCTGGAGCAACCAC -3'
(R):5'- TTCTCATCACCTGGCCGTAG -3'

Sequencing Primer
(F):5'- ACAGCGTCATCACGGAGTTC -3'
(R):5'- ATCACCTGGCCGTAGAGCAG -3'
Posted On2015-05-15