Incidental Mutation 'R4095:Fmnl2'
ID317835
Institutional Source Beutler Lab
Gene Symbol Fmnl2
Ensembl Gene ENSMUSG00000036053
Gene Nameformin-like 2
Synonyms5430425K04Rik, man
MMRRC Submission 040858-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R4095 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location52857860-53133804 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53101523 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 350 (D350G)
Ref Sequence ENSEMBL: ENSMUSP00000057084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049483] [ENSMUST00000050719] [ENSMUST00000090952] [ENSMUST00000127122] [ENSMUST00000155586]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049483
AA Change: D350G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047260
Gene: ENSMUSG00000036053
AA Change: D350G

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 8e-3 SMART
FH2 615 1052 1.66e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000050719
AA Change: D350G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057084
Gene: ENSMUSG00000036053
AA Change: D350G

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
FH2 581 1018 1.66e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090952
AA Change: D350G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088472
Gene: ENSMUSG00000036053
AA Change: D350G

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 6e-3 SMART
FH2 615 1052 1.66e-124 SMART
low complexity region 1063 1075 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127122
AA Change: D350G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118658
Gene: ENSMUSG00000036053
AA Change: D350G

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 7e-3 SMART
FH2 615 1052 1.66e-124 SMART
Predicted Effect unknown
Transcript: ENSMUST00000155586
AA Change: D350G
SMART Domains Protein: ENSMUSP00000117822
Gene: ENSMUSG00000036053
AA Change: D350G

DomainStartEndE-ValueType
Pfam:FH2 1 131 2e-33 PFAM
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a formin-related protein. Formin-related proteins have been implicated in morphogenesis, cytokinesis, and cell polarity. Alternatively spliced transcript variants encoding different isoforms have been described but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 A T 12: 53,139,462 I1220L probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Apba1 A T 19: 23,944,024 Q737L probably benign Het
Arvcf T A 16: 18,401,577 D564E probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Brd9 G A 13: 73,944,799 V302I probably benign Het
Brinp3 C A 1: 146,901,692 H626N possibly damaging Het
C1qc T C 4: 136,890,326 N153S probably benign Het
Casp3 G A 8: 46,634,216 G66D probably damaging Het
Coq7 T G 7: 118,527,478 probably null Het
Dach1 C T 14: 97,901,379 V491M possibly damaging Het
Dda1 A G 8: 71,473,792 T52A possibly damaging Het
Entpd7 A G 19: 43,704,201 Y65C probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Gbp2 A G 3: 142,637,449 T576A probably benign Het
Gm15446 T A 5: 109,940,724 probably null Het
Gtf2a1 G T 12: 91,575,637 T57K possibly damaging Het
Hps5 T C 7: 46,775,794 E494G probably benign Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Hydin A G 8: 110,541,547 N2886S probably damaging Het
Ighv2-6-8 T C 12: 113,796,153 Y112C probably damaging Het
Kcnf1 A T 12: 17,175,479 L247Q possibly damaging Het
Kndc1 A G 7: 139,937,025 M1606V possibly damaging Het
Krt27 T C 11: 99,345,793 T431A probably benign Het
Lama4 A T 10: 39,097,122 I1562F probably damaging Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp1b G A 2: 41,449,191 T880I probably benign Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Mapt T C 11: 104,310,536 probably null Het
Mpdz A T 4: 81,383,823 V229D possibly damaging Het
Olfr1349 T A 7: 6,515,253 S59C possibly damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr49 T C 14: 54,282,731 T55A probably benign Het
Parm1 T C 5: 91,594,180 S136P probably benign Het
Pcdhgb2 T A 18: 37,690,950 S331R probably benign Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Rell1 C A 5: 63,968,670 V22L probably benign Het
Sema6c T A 3: 95,173,194 L901Q probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a23 A G 13: 34,305,206 L116P probably damaging Het
Slit1 A T 19: 41,608,486 probably benign Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Tmem104 T A 11: 115,243,923 Y427* probably null Het
Tmem74 G A 15: 43,867,282 Q122* probably null Het
Tnpo2 T A 8: 85,038,419 L10Q probably damaging Het
Trav6-2 G T 14: 52,667,815 A98S probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ube2b A C 11: 51,997,827 V39G possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Wnk1 G A 6: 119,948,126 T1459I probably damaging Het
Zc3h7a T C 16: 11,145,235 K754R probably damaging Het
Zfp605 A G 5: 110,127,736 K240R probably damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Other mutations in Fmnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fmnl2 APN 2 53114917 missense probably damaging 1.00
IGL00960:Fmnl2 APN 2 53123482 missense probably damaging 0.98
IGL01343:Fmnl2 APN 2 53123545 missense probably damaging 1.00
IGL01790:Fmnl2 APN 2 53118368 missense probably damaging 1.00
IGL02555:Fmnl2 APN 2 53126851 critical splice acceptor site probably null
IGL02613:Fmnl2 APN 2 53073735 critical splice donor site probably null
IGL02712:Fmnl2 APN 2 53036498 splice site probably benign
IGL02715:Fmnl2 APN 2 53072210 missense possibly damaging 0.93
IGL02750:Fmnl2 APN 2 53103697 missense possibly damaging 0.95
IGL02832:Fmnl2 APN 2 52858249 missense possibly damaging 0.90
IGL02975:Fmnl2 APN 2 53101482 missense probably benign 0.45
PIT4280001:Fmnl2 UTSW 2 53118196 missense unknown
R0529:Fmnl2 UTSW 2 53042365 missense probably damaging 1.00
R0571:Fmnl2 UTSW 2 53054491 missense probably benign 0.01
R0707:Fmnl2 UTSW 2 53054486 missense possibly damaging 0.85
R1172:Fmnl2 UTSW 2 53072274 missense probably damaging 1.00
R1473:Fmnl2 UTSW 2 52858207 missense possibly damaging 0.53
R1533:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1536:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1537:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1547:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1548:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1549:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1604:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1608:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1615:Fmnl2 UTSW 2 53118424 missense probably damaging 1.00
R1792:Fmnl2 UTSW 2 53042317 missense possibly damaging 0.79
R1965:Fmnl2 UTSW 2 53114868 missense probably damaging 1.00
R1970:Fmnl2 UTSW 2 53105576 missense possibly damaging 0.93
R2012:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2065:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2111:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2112:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2427:Fmnl2 UTSW 2 53116979 missense probably damaging 0.96
R4084:Fmnl2 UTSW 2 53107495 missense possibly damaging 0.96
R4607:Fmnl2 UTSW 2 53103716 missense possibly damaging 0.94
R4608:Fmnl2 UTSW 2 53103716 missense possibly damaging 0.94
R4720:Fmnl2 UTSW 2 53107540 missense possibly damaging 0.96
R4731:Fmnl2 UTSW 2 53117069 missense possibly damaging 0.95
R4947:Fmnl2 UTSW 2 53073710 missense probably benign 0.32
R5015:Fmnl2 UTSW 2 53103761 missense possibly damaging 0.85
R5402:Fmnl2 UTSW 2 53128782 missense probably damaging 0.97
R5731:Fmnl2 UTSW 2 53118137 intron probably null
R5766:Fmnl2 UTSW 2 53101454 missense probably damaging 1.00
R5945:Fmnl2 UTSW 2 53114199 missense probably damaging 0.99
R6093:Fmnl2 UTSW 2 53114868 missense probably damaging 1.00
R6210:Fmnl2 UTSW 2 53130445 missense possibly damaging 0.94
R6287:Fmnl2 UTSW 2 53014848 missense probably damaging 1.00
R6661:Fmnl2 UTSW 2 53108285 missense probably damaging 0.98
R6967:Fmnl2 UTSW 2 53097332 missense possibly damaging 0.88
R7006:Fmnl2 UTSW 2 53108254 missense probably benign 0.27
R7146:Fmnl2 UTSW 2 53068540 missense
Predicted Primers PCR Primer
(F):5'- TTGTGAAATGAAGTGCCTATTCTGG -3'
(R):5'- CCAGTATTAAAAGGCTGCAGGC -3'

Sequencing Primer
(F):5'- CATTTCAGGTGGCCTCTA -3'
(R):5'- GGCCCAGGAATTCTGTAAGTACTC -3'
Posted On2015-05-15