Incidental Mutation 'R4095:Gbp2'
ID317837
Institutional Source Beutler Lab
Gene Symbol Gbp2
Ensembl Gene ENSMUSG00000028270
Gene Nameguanylate binding protein 2
Synonyms
MMRRC Submission 040858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R4095 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location142620602-142638008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142637449 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 576 (T576A)
Ref Sequence ENSEMBL: ENSMUSP00000132435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165774]
Predicted Effect probably benign
Transcript: ENSMUST00000165774
AA Change: T576A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132435
Gene: ENSMUSG00000028270
AA Change: T576A

DomainStartEndE-ValueType
Pfam:GBP 18 280 7.5e-124 PFAM
Pfam:GBP_C 282 578 1.3e-120 PFAM
Meta Mutation Damage Score 0.0992 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to increased susceptibility to chronic Toxoplasma gondii infection, characterized by an increased parasite burden in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 A T 12: 53,139,462 I1220L probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Apba1 A T 19: 23,944,024 Q737L probably benign Het
Arvcf T A 16: 18,401,577 D564E probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Brd9 G A 13: 73,944,799 V302I probably benign Het
Brinp3 C A 1: 146,901,692 H626N possibly damaging Het
C1qc T C 4: 136,890,326 N153S probably benign Het
Casp3 G A 8: 46,634,216 G66D probably damaging Het
Coq7 T G 7: 118,527,478 probably null Het
Dach1 C T 14: 97,901,379 V491M possibly damaging Het
Dda1 A G 8: 71,473,792 T52A possibly damaging Het
Entpd7 A G 19: 43,704,201 Y65C probably damaging Het
Fmnl2 A G 2: 53,101,523 D350G probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Gm15446 T A 5: 109,940,724 probably null Het
Gtf2a1 G T 12: 91,575,637 T57K possibly damaging Het
Hps5 T C 7: 46,775,794 E494G probably benign Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Hydin A G 8: 110,541,547 N2886S probably damaging Het
Ighv2-6-8 T C 12: 113,796,153 Y112C probably damaging Het
Kcnf1 A T 12: 17,175,479 L247Q possibly damaging Het
Kndc1 A G 7: 139,937,025 M1606V possibly damaging Het
Krt27 T C 11: 99,345,793 T431A probably benign Het
Lama4 A T 10: 39,097,122 I1562F probably damaging Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp1b G A 2: 41,449,191 T880I probably benign Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Mapt T C 11: 104,310,536 probably null Het
Mpdz A T 4: 81,383,823 V229D possibly damaging Het
Olfr1349 T A 7: 6,515,253 S59C possibly damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr49 T C 14: 54,282,731 T55A probably benign Het
Parm1 T C 5: 91,594,180 S136P probably benign Het
Pcdhgb2 T A 18: 37,690,950 S331R probably benign Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Rell1 C A 5: 63,968,670 V22L probably benign Het
Sema6c T A 3: 95,173,194 L901Q probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a23 A G 13: 34,305,206 L116P probably damaging Het
Slit1 A T 19: 41,608,486 probably benign Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Tmem104 T A 11: 115,243,923 Y427* probably null Het
Tmem74 G A 15: 43,867,282 Q122* probably null Het
Tnpo2 T A 8: 85,038,419 L10Q probably damaging Het
Trav6-2 G T 14: 52,667,815 A98S probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ube2b A C 11: 51,997,827 V39G possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Wnk1 G A 6: 119,948,126 T1459I probably damaging Het
Zc3h7a T C 16: 11,145,235 K754R probably damaging Het
Zfp605 A G 5: 110,127,736 K240R probably damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Other mutations in Gbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Gbp2 APN 3 142633480 missense probably damaging 1.00
IGL02055:Gbp2 APN 3 142632230 missense probably benign 0.16
IGL03024:Gbp2 APN 3 142632019 missense probably damaging 1.00
P4717OSA:Gbp2 UTSW 3 142630596 missense possibly damaging 0.63
PIT4445001:Gbp2 UTSW 3 142637466 missense probably benign
R0267:Gbp2 UTSW 3 142630106 missense probably benign 0.00
R0507:Gbp2 UTSW 3 142630033 missense probably damaging 1.00
R0601:Gbp2 UTSW 3 142630758 missense possibly damaging 0.47
R1005:Gbp2 UTSW 3 142630501 splice site probably benign
R1006:Gbp2 UTSW 3 142637422 missense probably damaging 1.00
R1795:Gbp2 UTSW 3 142630523 missense possibly damaging 0.61
R1893:Gbp2 UTSW 3 142630172 splice site probably benign
R2398:Gbp2 UTSW 3 142633362 missense probably benign 0.01
R3978:Gbp2 UTSW 3 142629986 missense possibly damaging 0.88
R4490:Gbp2 UTSW 3 142623764 missense probably benign 0.30
R5799:Gbp2 UTSW 3 142632082 missense probably benign
R5834:Gbp2 UTSW 3 142633377 missense probably damaging 0.98
R6159:Gbp2 UTSW 3 142632257 missense probably damaging 0.99
R6237:Gbp2 UTSW 3 142632032 missense probably benign
R6494:Gbp2 UTSW 3 142632008 missense probably damaging 0.98
R6982:Gbp2 UTSW 3 142630085 missense probably damaging 1.00
R7190:Gbp2 UTSW 3 142633447 missense probably benign 0.15
Z1088:Gbp2 UTSW 3 142630015 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTATAAGCTTTGGTGGGAGACAAGG -3'
(R):5'- TGACCCCAAAATGGAGTCGC -3'

Sequencing Primer
(F):5'- TGTTAAAGGTGGAAAAGGCTTC -3'
(R):5'- CCCCAAAATGGAGTCGCATATGATTG -3'
Posted On2015-05-15