Incidental Mutation 'R4095:Krt27'
ID317867
Institutional Source Beutler Lab
Gene Symbol Krt27
Ensembl Gene ENSMUSG00000017588
Gene Namekeratin 27
SynonymsmIRSa3.1, Krt1-c29
MMRRC Submission 040858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4095 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99345565-99351104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99345793 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 431 (T431A)
Ref Sequence ENSEMBL: ENSMUSP00000017732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017732]
Predicted Effect probably benign
Transcript: ENSMUST00000017732
AA Change: T431A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000017732
Gene: ENSMUSG00000017588
AA Change: T431A

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
low complexity region 36 61 N/A INTRINSIC
Filament 73 388 6.3e-151 SMART
Meta Mutation Damage Score 0.012 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The mouse type I keratin genes are clustered in a region of chromosome 11. The encoded protein is involved in the formation of intermediate filaments in the inner root sheath. [provided by RefSeq, Sep 2015]
PHENOTYPE: Newborn heterozygotes show a slight bending of the whiskers. At ~P12, the coat develops a loose wave pattern. Whiskers of homozygotes are more curly and irregular while coat waviness occurs earlier and is more prominent. Adult coats are not waved but remains rough in texture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 A T 12: 53,139,462 I1220L probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Apba1 A T 19: 23,944,024 Q737L probably benign Het
Arvcf T A 16: 18,401,577 D564E probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Brd9 G A 13: 73,944,799 V302I probably benign Het
Brinp3 C A 1: 146,901,692 H626N possibly damaging Het
C1qc T C 4: 136,890,326 N153S probably benign Het
Casp3 G A 8: 46,634,216 G66D probably damaging Het
Coq7 T G 7: 118,527,478 probably null Het
Dach1 C T 14: 97,901,379 V491M possibly damaging Het
Dda1 A G 8: 71,473,792 T52A possibly damaging Het
Entpd7 A G 19: 43,704,201 Y65C probably damaging Het
Fmnl2 A G 2: 53,101,523 D350G probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Gbp2 A G 3: 142,637,449 T576A probably benign Het
Gm15446 T A 5: 109,940,724 probably null Het
Gtf2a1 G T 12: 91,575,637 T57K possibly damaging Het
Hps5 T C 7: 46,775,794 E494G probably benign Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Hydin A G 8: 110,541,547 N2886S probably damaging Het
Ighv2-6-8 T C 12: 113,796,153 Y112C probably damaging Het
Kcnf1 A T 12: 17,175,479 L247Q possibly damaging Het
Kndc1 A G 7: 139,937,025 M1606V possibly damaging Het
Lama4 A T 10: 39,097,122 I1562F probably damaging Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp1b G A 2: 41,449,191 T880I probably benign Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Mapt T C 11: 104,310,536 probably null Het
Mpdz A T 4: 81,383,823 V229D possibly damaging Het
Olfr1349 T A 7: 6,515,253 S59C possibly damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr49 T C 14: 54,282,731 T55A probably benign Het
Parm1 T C 5: 91,594,180 S136P probably benign Het
Pcdhgb2 T A 18: 37,690,950 S331R probably benign Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Rell1 C A 5: 63,968,670 V22L probably benign Het
Sema6c T A 3: 95,173,194 L901Q probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a23 A G 13: 34,305,206 L116P probably damaging Het
Slit1 A T 19: 41,608,486 probably benign Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Tmem104 T A 11: 115,243,923 Y427* probably null Het
Tmem74 G A 15: 43,867,282 Q122* probably null Het
Tnpo2 T A 8: 85,038,419 L10Q probably damaging Het
Trav6-2 G T 14: 52,667,815 A98S probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ube2b A C 11: 51,997,827 V39G possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Wnk1 G A 6: 119,948,126 T1459I probably damaging Het
Zc3h7a T C 16: 11,145,235 K754R probably damaging Het
Zfp605 A G 5: 110,127,736 K240R probably damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Other mutations in Krt27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Krt27 APN 11 99348721 missense probably damaging 0.98
R1957:Krt27 UTSW 11 99346483 critical splice donor site probably null
R2014:Krt27 UTSW 11 99349492 missense probably benign 0.09
R4768:Krt27 UTSW 11 99349525 missense probably damaging 1.00
R4975:Krt27 UTSW 11 99346896 nonsense probably null
R5236:Krt27 UTSW 11 99350815 missense possibly damaging 0.87
R6750:Krt27 UTSW 11 99348980 missense probably damaging 0.96
R7044:Krt27 UTSW 11 99346814 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGCATCACCAGAGAGAAAGTC -3'
(R):5'- GCTCTATGAGGCGTTCATGGT -3'

Sequencing Primer
(F):5'- CCAGAGAGAAAGTCAAAGAATGTCAC -3'
(R):5'- TTCGCAGCTCTAGAATGACG -3'
Posted On2015-05-15